Labshake search
Citations for New England Biolabs :
51 - 100 of 10000+ citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: The pIGLR-2∷mCherry construct was generated with a Gibson assembly cloning kit (NEB) with the following four fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... or NEBNext Ultra II DNA Library Prep Kit for Illumina (replicate 2: NEB, E7645S), according to the manufacturers’ protocols ...
-
bioRxiv - Bioengineering 2022Quote: ... 120 nM fluorescent beacon and 1 U.μL-1 murine RNase Inhibitor (NEB M0314) in the reaction buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 μL of SYTO-9 dsDNA dye (NEB BioLabs, for LAMP fluorescent curve) was used to monitor the real-time amplification signals ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 μL of SYTO-9 dsDNA dye (NEB BioLabs, for LAMP fluorescent curve) was used to monitor the real-time amplification signals ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μL T7 RNA Polymerase mix (HiScribe T7 High Yield RNA Synthesis Kit, NEB) were incubated at 37°C for 3 h ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing libraries were prepared using the NEBNext ARTIC SARS-CoV-2 Library Prep Kit (NEB) and ARTIC V3 (MHome ...
-
bioRxiv - Microbiology 2022Quote: ... and library preparation was performed using the NEBNext ARTIC SARS-CoV-2 FS kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Purified round 2 PCR products were cloned using the NEB PCR Cloning Kit (NEB, #E1202) and sequenced with Sanger sequencing.
-
bioRxiv - Synthetic Biology 2023Quote: ... containing oligo pool template at 3.33 pg/μL and LAMP Fluorescent Dye (B1700, NEB) at 0.5X was aliquoted across a PCR plate ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μL GlycoBuffer 2 10X (NEB), 2 μL NP-40 ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment(anti-sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Microbiology 2022Quote: ... a sequencing library was constructed with the NEBNext ARTIC SARS-CoV-2 FS kit (NEB E7658S). For each viral variant ...
-
bioRxiv - Cancer Biology 2023Quote: ... TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Molecular Biology 2023Quote: crRNA (Supplementary Table 2) was synthesized using a HiScribe T7 High Yield RNA Synthesis Kit (NEB). The DNA sequences includes the T7 promoter at the 5’ end and the sequence from crRNA with the target sequence at the 3’ end ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: mRNA was isolated from 6-well plates showing a cell confluency of ∼90% using the Monarch Total RNA Miniprep kit (NEB). siRNA transfection was performed 48 hours prior to RNA isolation using the Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... The nicked DNA was labeled with a fluorescent-dUTP nucleotide analog using Taq polymerase (NEB) for 1 hr at 72° ...
-
bioRxiv - Genomics 2019Quote: ... The nicked DNA was labeled with a fluorescent-dUTP nucleotide analog using Taq polymerase (NEB) for one hour at 72°C ...
-
bioRxiv - Genomics 2019Quote: ... The nicked DNA was labeled with a fluorescent-dUTP nucleotide analog using Taq polymerase (NEB) for one hour at 72°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Microbiology 2020Quote: cDNA was synthesized from 2 μg RNA using the ProtoScript II First Strand cDNA Synthesis Kit (NEB) per manufacture’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA from 2 biological replicates was purified with Monarch PCR & DNA Cleanup Kit (Cat. no. T1030, NEB). Library preparation ...
-
bioRxiv - Genetics 2020Quote: ... corresponding to the point mutation in the SARS-CoV-2 genome (Q5 Site-directed mutagenesis kit, NEB). Site directed mutagenesis primers (Table S1 ...
-
bioRxiv - Cancer Biology 2021Quote: Libraries were prepared using the NEBNext Ultra 2 DNA Library Preparation Kit (New England Biolabs, MA, USA) with AMPure® XP Beads (Beckman Coulter ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Genetics 2023Quote: ... 2 μg of total RNA was converted into cDNA with LunaScript RT SuperMix kit (New England Biolabs). The cDNAs were used as templates for real-time PCR and ran on StepOnePlus real-time PCR system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using the Luna® SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB) with the CDC-derived primers for N1 and N2 gene targets and the reaction was performed using the QuantStudio™ 5 System (ThermoFisher) ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA was isolated from ∼2×106 cells using the Monarch DNA purification Kit (New England Biolabs). For genotyping ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Cell Biology 2023Quote: ... with C-terminal fluorescent tags using seamless cloning (HiFi DNA Assembly Master Mix, New England Biolabs). The pLVX-KRT5-mNG-IRES-Puro construct includes an mNeonGreen (Allele Biotechnology)6 sequence in-frame with the KRT5 sequence separated by a short peptide linker (DPAFLY) ...
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs; version 6.0 – 2/18) using NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1 (#E7600S ...
-
bioRxiv - Molecular Biology 2020Quote: Library preparation: TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized on 2 µg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by detection of ubiquitinated substrate by immunoblotting using anti-MBP (New England Biolabs), anti-GST and anti-ubiquitin (Santa Cruz Biotechnology ...