Labshake search
Citations for New England Biolabs :
51 - 100 of 3377 citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... Assembled products were heat-shock transformed to 5-alpha (NEB), TOP10 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... Assembled plasmids were transformed into NEB 5-alpha F’Iq (NEB) and standard chemically competent Escherichia coli transformation protocols were used to construct plasmid host strains ...
-
bioRxiv - Cell Biology 2023Quote: ... NEB 5-alpha competent E.coli (NEB #C2987H, Ipswich, MA, USA) were transformed with ligated plasmid by heat shock at 42°C for 30 seconds ...
-
bioRxiv - Genomics 2023Quote: ... The library was transformed into 5-alpha electrocompetent cells (NEB), grown in liquid culture ...
-
bioRxiv - Genomics 2023Quote: ... The libraries were transformed into 5-alpha electrocompetent cells (NEB). The plasmid library was prepared by maxi-prep (Sigma) ...
-
bioRxiv - Bioengineering 2024Quote: ... grown in 5-alpha competent Escherichia coli (NEB, Ipswich, MA) and purified using the PureYield MidiPrep System (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... His/Strep-Tag was cleaved using enterokinase according to the protocol of the manufacturer (NEB) and GlnA3Mtwas immediately purified from the digestion mix by size-exclusion chromatography as directed by the resin manufacturer (GE-Healthcare).
-
bioRxiv - Molecular Biology 2022Quote: ... following the manufacture’s protocol. Plasmids were transformed in DH5-alpha or DH10-beta chemo-competent Escherichia coli (E. coli) cells (New England Biolabs). Transformed bacteria were grown in LB medium supplemented with 50 μg/mL kanamycin or 100 μg/mL carbenicillin ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Molecular Biology 2021Quote: ... Escherichia coli competent cells NEB 5-alpha (C2987, New England Biolabs), NEB Stable (C3040 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were transformed into either competent NEB 5-alpha F’Iq (NEB) or Epi400 (Lucigen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and were performed using 5-alpha F’ Iq cells (NEB C2992H).
-
bioRxiv - Biochemistry 2021Quote: ... The assembled product was transformed into 5-alpha competent cells (NEB) and the insert sequence was confirmed by Sanger sequencing (Source Bioscience) ...
-
bioRxiv - Developmental Biology 2022Quote: ... it was transformed into NEB 5-alpha competent E.coli (NEB #C2987). The sequence of donor plasmid was confirmed by Sanger sequencing using 5 primers to ensure that there are no disabling mutations in the scarless DsRed cassette or regions of the homology arms ...
-
bioRxiv - Immunology 2022Quote: ... and then transformed in NEB 5-alpha competent cells (NEB, C2987U). Expi293F (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... coli host strain NEB 5-alpha F’ lq (New England Biolabs) was exclusively used to generate ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transformed into NEB 5-alpha cells (New England Biolabs) and plated on LB plates with carbenicillin for selection purposes and incubated overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then transformed into 5-alpha competent Escherichia coli cells (NEB), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The HIS tag was removed from the mature sequence of AgLTP24 with enterokinase (NEB, Evry, France) for 16 h at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Tags (6x His or HA) were introduced using site-directed mutagenesis with KLD enzyme mix (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Genetics 2019Quote: ... coli was performed using DH5-alpha or its commercial derivative NEB 10-Beta (New England Biolabs product number C3019I or C3020). Genomic DNA of BY4741 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... The His-GST tags were cleaved by incubating the pooled fractions with TEV protease (New England Biolabs) at 4°C for 16h ...
-
bioRxiv - Bioengineering 2022Quote: ... The t-NLuc-His tag was double-digested with NdeI and XhoI restriction enzymes (New England BioLabs), and the RNA sensor region were digested with SgrAI and SacII restriction enzymes ...
-
bioRxiv - Microbiology 2021Quote: ... Ligations were used to transform NEB 5-alpha competent cells (NEB C2987H) and the cloned spacer was verified by Sanger sequencing using primer PSP108 ...
-
bioRxiv - Molecular Biology 2020Quote: ... transformed into NEB 5-alpha chemically competent Escherichia coli (New England BioLabs), and submitted for Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was transformed into NEB 5-alpha high efficiency competent cells (NEB). Insert size was verified with PCR and purified plasmids were sequenced using Sanger sequencing.
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Systems Biology 2023Quote: ... Each construct was transformed into standard 5-alpha competent bacteria (#C2987; NEB) grown overnight in in 500 ml of standard Luria Broth (LB ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli competent cells (NEB 5-alpha, New England Biolabs, Ipswich, MA, USA) that were cultured and prepared using a GenElute HP Plasmid Midi kit (NA0200-1KT ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Neuroscience 2019Quote: ... was first transformed into NEB 5-alpha competent cells (New England Biolabs #E2621S) and plated on LB plus ampicillin (60 µl/ml).
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation was directly transformed into NEB-5-alpha electrocompetent cells (NEB C2987H) and plated on LB-agar supplemented with carbenicillin (100 µg/mL) ...
-
bioRxiv - Biochemistry 2023Quote: ... NEB Stable (lentiviral vectors) and NEB 5-alpha (other plasmids) (New England Biolabs) were used as cloning strains ...
-
bioRxiv - Biochemistry 2021Quote: Toxins were expressed with (His)6-tags at their C-termini in competent C43 (DE3) Escherichia coli cells (NEB) for HlgA and in BL21 (DE3 ...
-
bioRxiv - Biophysics 2020Quote: ... The point mutants were subsequently cloned in the pNZopuAHis plasmid (C-terminal 6-HIS-tag) using EcoRV-AlnwnI (NEB) for the substrate-binding domain mutants and βamHI-AlwnI (NEB ...
-
bioRxiv - Biophysics 2020Quote: ... with TEV-cleavable 6x-His tag at N-terminal of the gene cloned between NheI (New England Biolabs Inc.) and HindIII (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ... 404–561 with a C terminal His tag added was cloned into the pMAL-c5x vector (New England Biolabs), and were transformed in E ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Molecular Biology 2023Quote: Hi-C libraries were treated with 3 U of T4 DNA polymerase (NEB) in the presence of 0.1 mM dGTP (NEB ...
-
bioRxiv - Immunology 2019Quote: ... PCR product was cloned into 5-alpha competent bacteria (New England Biolabs, cat. #C2987) using a TOPO TA cloning kit (Thermo Fischer Scientific ...
-
bioRxiv - Microbiology 2022Quote: Escherichia coli DNA adenine methyltransferase (dam)+/dcm+ (NEB 5-alpha competent E. coli, #C2987) and dam−/dcm− (dam−/dcm− competent E ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformations were performed using NEB 5-alpha chemically competent cells (New England BioLabs). E ...
-
bioRxiv - Microbiology 2023Quote: ... All the produced constructs were propagated in competent cells (5-alpha Competent E.coli; NEB) and isolated by NucleoSpin Plasmid (TaKaRa) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The HIS-SUMO-BAHEPR-1 fusion and HIS-SUMO tag constructs were expressed in Escherichia coli BL21 DE3 cells (New England BioLabs). Both HIS-SUMO-BAHEPR-1 and HIS-SUMO cultures were initially grown in 4 liters of LB media at 37 °C at 200 RPM until cultures reached an optical density of ∼ 1.0 at 600 nm and then cultures were pelleted ...
-
bioRxiv - Bioengineering 2019Quote: ... inserting a N-terminal TEV cleavage tag and cloned into a pET28a backbone in front of the His-tag using the NEBuilder HiFi DNA assembly method (NEB).
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...