Labshake search
Citations for New England Biolabs :
101 - 150 of 9484 citations for Human Tropomyosin alpha 4 chain TPM4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... was generated by reverse transcriptase polymerase chain reaction (PCR) using the ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA). Transcript levels were measured by real time PCR using SYBR green on an ABI 7500 system ...
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Microbiology 2022Quote: Eight units of enteropeptidase light chain (New England Biolabs, 16 units per µL) and 25 µg of Esp743 (50 µg/µL ...
-
bioRxiv - Microbiology 2020Quote: Polymerase chain reaction (PCR) was performed using Q5 DNA polymerase (New England Biolabs). For cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Neuroscience 2019Quote: ... was first transformed into NEB 5-alpha competent cells (New England Biolabs #E2621S) and plated on LB plus ampicillin (60 µl/ml).
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation was directly transformed into NEB-5-alpha electrocompetent cells (NEB C2987H) and plated on LB-agar supplemented with carbenicillin (100 µg/mL) ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmids were then transformed into DH5-alpha high-efficiency competent cells (NEB). Following transformation ...
-
bioRxiv - Biochemistry 2023Quote: ... NEB Stable (lentiviral vectors) and NEB 5-alpha (other plasmids) (New England Biolabs) were used as cloning strains ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... Human FBP1 mutants were constructed by Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) in the PCDH-V5-FBP1 vectors ...
-
bioRxiv - Immunology 2021Quote: ... gBlocks were amplified by polymerase chain reaction (PCR) using Q5 polymerase (New England BioLabs) following the manufacturer’s protocol ...
-
Imaging of Morphological and Biochemical Hallmarks of Apoptosis with Optimized Optogenetic ActuatorsbioRxiv - Biochemistry 2019Quote: The Cry2(1-531) gene was amplified by polymerase chain reaction (NEB Q5 polymerase) from the full length Cryptochrome-2 gene using a forward primer encoding an XhoI-restriction site with the sequence ...
-
bioRxiv - Genetics 2019Quote: ... the desired concentration for the PCR (Polymerase Chain Reaction) protocol (New England Biolabs Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA polymerase (NEB) and digested using NotI ...
-
bioRxiv - Molecular Biology 2023Quote: ... Polymerase chain reaction (PCR) was performed with Q5-HF polymerase (New England Biolabs, USA) or with CloneAmp Hifi polymerase (Takara Bio ...
-
bioRxiv - Synthetic Biology 2023Quote: Polymerase Chain Reaction (PCR) was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers synthesized by Integrated DNA Technologies (IDT ...
-
bioRxiv - Immunology 2019Quote: ... PCR product was cloned into 5-alpha competent bacteria (New England Biolabs, cat. #C2987) using a TOPO TA cloning kit (Thermo Fischer Scientific ...
-
bioRxiv - Microbiology 2022Quote: Escherichia coli DNA adenine methyltransferase (dam)+/dcm+ (NEB 5-alpha competent E. coli, #C2987) and dam−/dcm− (dam−/dcm− competent E ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformations were performed using NEB 5-alpha chemically competent cells (New England BioLabs). E ...
-
bioRxiv - Biochemistry 2022Quote: ... aliquots of S proteins were digested respectively using alpha lytic protease (New England BioLabs), chymotrypsin (Athens Research and Technology) ...
-
bioRxiv - Microbiology 2023Quote: ... All the produced constructs were propagated in competent cells (5-alpha Competent E.coli; NEB) and isolated by NucleoSpin Plasmid (TaKaRa) ...
-
bioRxiv - Genomics 2024Quote: ... Ligation products were transformed into either 5-alpha or 10-beta electrocompetent cells (NEB) and grown in liquid LB-Amp cultures ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared using the NEBNext Immune Sequencing Kit for Human (New England Biolabs) according to the manufacturer’s instructions without modifications ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions (PCR) were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs), and gel-purified products (hph and the gene of unknown function with 73% homology to an AAC(2’)-IIa resistance gene ...
-
bioRxiv - Microbiology 2019Quote: ... Polymerase Chain Reaction (PCR) was conducted following standard conditions outlined by New England Biolabs (NEB) (Ipswich ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL proteoliposomes were mixed with 8 units of enterokinase light chain (New England Biolabs) and diluted to 20 μL ...
-
bioRxiv - Immunology 2020Quote: Heavy and light chain vectors were verified by sequencing and transformed into DH5alpha cells (NEB). The transformed cells were grown and the plasmid was purified by midiprep (Macherey-Nagel) ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 genes by polymerase chain reaction (PCR) using Phusion® HF (New England Biolabs). PCR products were gel extracted and sequenced to determine the full-length P ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all linear polymerase chain reaction (PCR) products (Q5 High-Fidelity DNA Polymerase, New England Biolabs) were extracted by gel extraction and then ligated using NovoRec plus One step PCR Cloning Kit (Novoprotein) ...
-
bioRxiv - Zoology 2023Quote: ... Polymerase chain reaction (PCR) was performed using LongAmp Taq 2X Master Mix (New England Biolabs) and previously described primers GLU (5’ GACTTGAAGAACCACCGTTG 3’ ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... a mix of 4 μl First strand Synthesis Reaction Buffer (NEB-kit), 0.5 μl Murine RNase Inhibitor (NEB-kit ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli using standard transformation techniques with NEB 5-Alpha chemically competent cells (New England BioLabs), and to C ...
-
bioRxiv - Synthetic Biology 2023Quote: All cloning was performed in NEB 5-alpha Competent Escherichia coli (New England BioLabs C2987U). The Pseudomonas putida KT2440 strain was purchased from ATCC (#47054) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The assembled plasmid was introduced into Escherichia coli strain NEB 5-alpha (New England Biolabs) by heat shocking ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids were amplified in chemically competent 5-alpha F’Iq Escherichia coli cells (New England Biolabs) after 42°C heat shock transformation and extracted using the GenElute HP Plasmid Miniprep Kit (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... plasmids were chemically transformed into DH5-alpha cells (cat no. C2987, New England Biolabs Inc.) and plated on agar plates containing appropriate antibiotics ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were amplified using NEB 5-alpha F′ Iq competent Escherichia coli (NEB, Cat# C2992H) and extracted using the PureYield Plasmid Miniprep System (Promega ...
-
bioRxiv - Biophysics 2021Quote: An in-frame fusion between the human 5-HT5AR from the Presto-Tango cDNA library (4) and the human Gαi1 was made via HiFi DNA assembly (New England Biolabs, Ipswich, MA). Mutations of key contact points between docked ligands and the human 5-HT5AR binding pocket were made via site-directed mutagenesis as directed (Stratagene ...
-
bioRxiv - Molecular Biology 2021Quote: ... depleted with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat, NEB, Figures 6 and S6), or not depleted (Figures 2B ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: DNA from human cells was isolated using the Monarch®Genomic DNA Purification Kit (NEB) following the manufacturer’s instructions and including the recommended RNaseA digestion step ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: RNA from human cells was isolated using the Monarch®Total RNA Miniprep Kit (NEB) following the manufacturer’s instructions and including the on-column DnaseI digestion ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat; NEB, E6310X). rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Polymerase chain reactions (PCRs) were carried out with Q5 Hot Start High-Fidelity DNA polymerase (NEB). Colony PCRs were performed with Taq polymerase (NEB) ...
-
bioRxiv - Systems Biology 2020Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...