Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... The human μOR and V2R were amplified with a SNAP tag at their N-terminal (NEB) and subcloned in the pcDNA4/TO plasmid (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: Removal of N-linked oligosaccharides in mini-procollagens was performed with PNGase F (New England BioLabs, glycerol-free). Ten micrograms of mini-procollagens were first denatured at 100 °C for 10 min in Glycoprotein Denaturing Buffer provided with the enzyme ...
-
bioRxiv - Biochemistry 2022Quote: ... The N-terminal deletions were made using the HiFi DNA cloning kit from NEB to excise portions of the N-terminus of the gene ...
-
bioRxiv - Biochemistry 2022Quote: ... as N-terminal VP16 fusions using HiFi assembly (NEB). The human ERG ETS domain ...
-
bioRxiv - Neuroscience 2023Quote: ... Generation of Adgrd1 N-terminal mutations was carried out using Q5 site directed mutagenesis kit (NE Biolabs) using manufacturers protocol ...
-
bioRxiv - Genetics 2022Quote: ... at the N-terminal by using SalI (New England Biolabs, # R3138S) and NotI (New England Biolabs ...
-
bioRxiv - Plant Biology 2024Quote: ... and SLAC1 cDNAs (N-terminal or C-terminal) were cloned in-frame into pMAL-c5X vector (New England Biolabs) using In-Fusion HD Cloning Kit (Takara Bio) ...
-
bioRxiv - Genetics 2023Quote: N-terminal GST-fusion TF DBD proteins were expressed using the PURExpress in vitro transcription/translation kit (NEB) following the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2022Quote: ... was cloned into pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). The exact same purification scheme for DDX5(1-535)-SNAP was used to purify DDX5(1-483)-SNAP and the protein was flash frozen in medium salt storage buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2022Quote: The full-length African killifish DDX5 was cloned into the pDEST17 vector containing an N-terminal His10-tag and a C-terminal SNAP-tag (New England BioLabs). E ...
-
bioRxiv - Neuroscience 2022Quote: The full-length African killifish DDX5 was cloned into the pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). E ...
-
bioRxiv - Neuroscience 2022Quote: ... was cloned into the pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). The same purification scheme was used to purify DDX5(1-535)-SNAP than DDX5-SNAP ...
-
bioRxiv - Genetics 2024Quote: ... Sequences encoding N-terminal Ana1 fragments were fused with C-terminal RFP using the Gibson Assembly system (New England Biolabs) before cloned into the modified vector.
-
bioRxiv - Genetics 2024Quote: ... the N-terminal part of ABEmax was digested by NotI (NEB, R3189L) and BglII (Enzynomics ...
-
bioRxiv - Cell Biology 2020Quote: ... addition of a N-terminal Hemagglutinin (HA) epitope was done using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) following manufacturer recommendations.
-
bioRxiv - Biochemistry 2024Quote: ... a vector containing an N-terminal Thioredoxin-His10 tag using a Gibson Assembly® Cloning Kit (New England BioLabs). Plasmids were extracted and transformed into competent E ...
-
bioRxiv - Microbiology 2024Quote: ... N-4005, and N-4004) were used to cap available 3’-terminal ends using terminal transferase (1 µl, 20 units) (NEB #M0315S), TdT reaction buffer (1.5 µl) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and cloned into overexpression vectors under act5 promoter with either N-terminal or C-terminal FLAG tags using Gibson Assembly® Master Mix (NEB, E2611L) at 50 °C for 1 hr ...
-
bioRxiv - Cell Biology 2022Quote: ... An IFT144 construct lacking the N-terminal β-propeller domain (residues 2–349 inclusive; IFT144ΔNFLAG) was made using the Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2021Quote: ... together with an N-terminal FLAG-emGFP-tag via NheI and NotI (both New England Biolabs) restriction sites ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... with an N-terminal V5 tag and linker using Gibson Assembly (New England Biolabs, Ipswich, MA). Human RIPK4 (NP_065690.2 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... with an N-terminal V5 tag and linker using Gibson Assembly (New England Biolabs, Ipswich, MA). Kinase mutants for human proteins RIPK1 (D138N) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Three recB fragments were directly assembled into pET28c vector in frame with the N-terminal 6xHis tag employing NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, Inc., Ipswich, MA, USA). Wild type RecC encoding gene was individually sub-cloned into pET28c vector in frame with the N-terminal 6xHis tag ...
-
STARCH SYNTHASE 4 is required for normal starch granule initiation in amyloplasts of wheat endospermbioRxiv - Plant Biology 2021Quote: ... in frame with the N-terminal His6-tag using the Gibson assembly master mix (New England Biolabs) for TaSS4-1B ...
-
bioRxiv - Biochemistry 2021Quote: The full-length PARP1 gene was purchased from GE Healthcare and subcloned into a pACEBac1 plasmid bearing an N-terminal 6xHis-tag via a Gibson Assembly (NEB). The PARP2 expression plasmid (C-terminal FLAG-6xHis-tag ...
-
bioRxiv - Cell Biology 2023Quote: cDNA encoding recombinant MUC17(7TR) with N-terminal 3xFlag tag was generated using Gibson Assembly (E2611S, NEB) following the manufactures protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cascade complexes were purified via the N-terminal maltose binding protein (MBP) tag using amylose beads (NEB) and eluted with lysis buffer containing 10 mM maltose ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cole) containing an N-terminal 6×His-tag using NEBuilder HiFi DNA Assembly Master Mix (NEB E2621L). The LSD1 constructs were expressed in BL21-CodonPlus (DE3)-RIPL competent E ...
-
bioRxiv - Biophysics 2020Quote: Recombinant wild-type human histone H1.0 (New England Biolabs, cat. # M2501S) was used for experiments with fluorescently-labeled nucleosomes ...
-
bioRxiv - Biophysics 2020Quote: N-terminal strep-6xHis-TEV mTagBFP2 RanQ69L was cloned into the pST50 vector via Gibson Assembly (New England Biolabs). The plasmid was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Sec24D was subcloned from pEGFP Sec24D into pcDNA3.1 with an N-terminal myc-6xHis tag using Gibson Assembly (E5510, New England Biolabs). pcDNA3.1 was linearized with Not1 (R3189 ...
-
bioRxiv - Biophysics 2020Quote: ... with TEV-cleavable 6x-His tag at N-terminal of the gene cloned between NheI (New England Biolabs Inc.) and HindIII (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification of the N-terminal region of TRIM1 was performed using Q5 High-Fidelity 2X Master Mix (New England BioLabs) with the primers ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were expressed as N-terminal His6-Smt3 fusion constructs from either pET28-b vectors (expressed in T7 Express lysY/Iq (NEB) Escherichia coli (E ...
-
bioRxiv - Biochemistry 2021Quote: pMAL-c4E vectors carrying in-frame fusions of the EFR cytoplasmic domain with the N-terminal maltose-binding protein (MBP) tag were transformed into Rosetta 2 cells (NEB) for recombinant protein expression ...
-
bioRxiv - Biochemistry 2020Quote: ... a maltose binding protein (MBP) and a Tobacco Etch Virus (TEV) protease cleavage site in the N-terminal via Gibson assembly (New England Biolabs) as per the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2021Quote: AcpP was expressed from a pET28a plasmid encoding acpP with a thrombin-cleavable N-terminal 6xHis tag in C3031I cells (NEB). 2L cultures of LB supplemented with kanamycin (25 μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... and cloned into the pZE13d vector (Lutz and Bujard, 1997) with an N-terminal 6xHis tag via Gibson assembly (Hifi DNA Assembly, NEB) using ClaI and PstI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... open reading frames were cloned into a linearized pET28b vector with BamH1 and Xho1 in frame with a N- terminal 6x-His tag using Gibson HiFi assembly mix (NEB), 10 μL total reaction volume with 2 μL of linearized vector ...
-
bioRxiv - Genomics 2021Quote: The AID N-terminal AID-RPB1 vector was assembled by Gibson Assembly (NEBuilder HiFi DNA Assembly Master Mix, NEB, E2621L) in the pENTR221 kanamycin vector using the following templates ...
-
bioRxiv - Biochemistry 2021Quote: ... using a plasmid that codes for the desired protein sequence fused to an N-terminal intein and chitin binding domain (CBD) as part of the IMPACT purification system (NEB). 2 liters of cells were grown to an OD600 of 0.6 and induced with 1 mM IPTG for 3 hours at 25 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was inserted into a gel-purified N-terminal sub-cloning vector digested with MluI and KpnI restriction enzymes (New England Biolabs). Cas13 C-terminal fragments were also PCR amplified out of the full Cas13 sequence templates mentioned above to contain a 5′ sequence to code for the KpnI restriction site a start codon ...
-
bioRxiv - Microbiology 2022Quote: ... and Atd1 and containing an N-terminal TEV cleavage site were cloned directly via Gibson assembly (NEBuilder HiFi, New England Biolabs) into BamHI/NotI-digested pGEX4-1 (GE Healthcare) ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCR8[mZC3H18] plasmid was used as a template to generate subsequent ZC3H18 cDNA constructs that were cloned into a piggyBAC (pB) vector containing an N-terminal MYC tag and BSD selection marker using NEBbuilder HiFI DNA assembly (NEB). OsTIR1-HA ...
-
bioRxiv - Plant Biology 2024Quote: ... in an N-terminal fusion (MIROs are tail anchored proteins) with mCherry that was generated by Gibson assembly (New England Biolabs, Ipswich ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing an N-terminal 6xHis tag and TEV site was produced in Escherichia coli NiCo21 (DE3) cells (New England Biolabs) as previously described in https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6069193/ ...
-
bioRxiv - Microbiology 2024Quote: ... crescentus NA1000 was PCR amplified from genomic DNA and cloned into pET28a with an N-terminal hexa-histidine tag using Gibson assembly (HiFi DNA Assembly Master Mix; New England Biolabs) to generate pET28a::cpaF ...