Labshake search
Citations for New England Biolabs :
251 - 300 of 9435 citations for Human Lysine K Specific Demethylase 1A KDM1A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 units/ml proteinase K (New England Biolabs P8107S) at 55°C for 30 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... then 0.2 mg/mL Proteinase K (New England Biolabs P8107S) for 30 min at 55°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 9ul of CutSmart buffer and 2ul of Proteinase K (NEB), followed by incubation at 56C for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... Samples were treated with Proteinase K (New England Biolabs, 8107) for 1 hr at 50°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.25M NaCl) and Proteinase K (New England Biolabs Inc (NEB)) were added and crosslinks were reversed overnight at 65°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 0.45% Tween 20 and 0.4 mg/ml Proteinase K (NEB). After 5 minutes incubation at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μl of proteinase-K (NEB, stock 20 mg/ml) was added and incubated at 37°C for 1 hour ...
-
bioRxiv - Genomics 2020Quote: ... 50 μL of 20mg/mL Proteinase K (New England Biolabs) and 57 μL of 10% SDS were mixed with the samples ...
-
bioRxiv - Genomics 2021Quote: ... 50 mM DTT and 40 units/ml proteinase K (NEB). Cells were suspended in PBS with 0.01% BSA at 100,000 cells/ml.
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were treated with Proteinase K (New England Biolabs P8107), extracted with phenol:chloroform:isoamyl alcohol (25:24:1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... ChIP samples and input were incubated with Proteinase K (NEB) at 65°C overnight to reverse formaldehyde crosslinking ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.25M NaCl) and Proteinase K (New England Biolabs Inc (NEB)) were added and crosslinks were reversed overnight at 65C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.25M NaCl) and Proteinase K (New England Biolabs Inc (NEB)) were added and crosslinks were reversed overnight at 65C ...
-
bioRxiv - Genetics 2023Quote: ... and 60 ng/μL Proteinase K (New England Biolabs; NEB)) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1% v/v proteinase K (New England Biolabs, P8107S) in 2×SSC for 36-48 hours at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and digested briefly (< 1 min) by 1% Proteinase K (NEB) in TE buffer at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... and 60 ng/μL Proteinase K (New England Biolabs; NEB)) ...
-
bioRxiv - Biochemistry 2023Quote: ... gels were digested overnight with proteinase K (New England Biolabs) at a concentration of 8 units/mL in digestion buffer (50 mM Tris (pH 8.0) ...
-
bioRxiv - Biophysics 2023Quote: ... and 60 ng/µL Proteinase K (New England Biolabs; NEB)) ...
-
bioRxiv - Biophysics 2023Quote: ... and 60 ng/µL Proteinase K (New England Biolabs; NEB)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by addition of 20 µl of Proteinase K (NEB) and another incubation at 65°C overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... Bound DNA was recovered using proteinase K (New England Biolabs), purified using QIAquick Nucleotide Removal kit (QIAGEN ...
-
bioRxiv - Bioengineering 2024Quote: ... Cleaved products were incubated with proteinase K (NEB, Ipswich, MA), A-tailed ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µl of thermolabile proteinase K (New England Biolabs, P811S) added to Mitochondria-bound beads resuspended in 30 µl of KPBS ...
-
bioRxiv - Genomics 2024Quote: ... ABE8e deaminated DNA products were treated with proteinase K (NEB), followed by Endonuclease V (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... Six microliters of proteinase K (20 mg/ml) (NEB, P8107S) were added ...
-
bioRxiv - Microbiology 2023Quote: ... Six microliters of proteinase K (20 mg/ml) (NEB, P8107S) were added ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... Human FBP1 mutants were constructed by Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) in the PCDH-V5-FBP1 vectors ...
-
bioRxiv - Cancer Biology 2019Quote: ... Strand-specific RNA-Seq libraries were constructed using the NEBNext Ultra Directional RNA Library Prep Kit (NEB, catalogue number: E7420). The resulting library concentrations were quantified using the Nanodrop ...
-
bioRxiv - Microbiology 2021Quote: ... was utilized using SARS-CoV-2 specific primers[43] or SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs), which became available in assays after September 15 ...
-
bioRxiv - Molecular Biology 2022Quote: 1 μg of total RNA was used to synthesize cDNA with dTALE gene specific primer dTALE-GSP_R0 (cgacttgagcagcaggagatgc) using the ProtoScript®II first strand cDNA synthesis kit (New England Biolabs) according to the manufacturer’s manual ...
-
bioRxiv - Neuroscience 2021Quote: ... Strand-specific RNASeq libraries were created using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB #6420L ...
-
bioRxiv - Molecular Biology 2022Quote: ... and used to generate a strand-specific library using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB). Nascent RNA-seq was conducted as previously described (Crump et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... Half of the eluted RNA was used for strand-specific RIP-Seq library preparation using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs).
-
bioRxiv - Genomics 2019Quote: ... polyA+ RNA and polyA-RNA were then made into a strand specific library using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) according to the manufacturers protocol (utilizing a 15-minute fragmentation step ...
-
bioRxiv - Immunology 2023Quote: ... Polyadenylated transcript enrichment and strand specific library preparation was completed using a NEBNext Ultra II mRNA kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-specific mutagenesis of double-stranded plasmid DNAs were constructed using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... and cloned into the vector pCE along with a 30 bp site specific spacer sequence (in the gene to be deleted) using Gibson assembly (Gibson Assembly Cloning Kit, New England Biolabs) using 1µg of fragments and plasmid at a 3:1 ratio then incubating at 50 °C for 4 hours ...
-
bioRxiv - Physiology 2023Quote: ... Five hundred micrograms of total RNA was used to prepare strand-specific libraries by the NEBNext Ultra II Directional RNA Library Preparation kit (NEB) and sequenced (75 nucleotides ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Final eluates were used as input for strand-specific RNA-seq library construction using the NEBNext RNA Library Prep Kit (New England Biolabs). Libraries were fractionated on 4% agarose E-gels (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... AnTat1.1 sequence was obtained from AnTat1.1 specific cDNA from mouse infection D6 cloned into a pMiniT vector with the PCR Cloning Kit (NEB, E1202S). VSG-228 was partially amplified from VSG PCR (see below ...
-
bioRxiv - Cell Biology 2023Quote: ... corresponding to a portion of PfRNF1 (RP2; Fig. 1A) was expressed as a maltose-binding fusion protein using the pMAL™c5X-vector (New England Biolabs, Ipswich, USA). To this end ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S-FL K-to-R and SARS-CoV-2 S-Truncated K-to-R) were generated using the Q5® site-directed mutagenesis kit (New England BioLabs Inc., #E0552S) or the QuickChangeSite-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Biochemistry 2021Quote: ... Quantification of libraries prior to sequencing used qPCR with primers specific to the Illumina P5 and P7 adaptor sequences and standards from the NEBNext Library Quant Kit (NEB, E7630S). Sequencing of prepared libraries was performed using an Illumina MiniSeq with the 75-cycle high-output kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Molecular Biology 2022Quote: ... strand specific RNA-seq libraries were generated using NEBNext polyA selection and Ultra Directional RNA library preparation kits (NEB, Hertfordshire, UK), multiplexed ...
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...
-
bioRxiv - Immunology 2020Quote: ... according to the manufacturer’s instructions.29 RNA reverse transcription and first strand cDNA synthesis were carried out using chain-specific reverse primers30 with ProtoScript® II First Strand cDNA Synthesis Kit (NEB). The resulting cDNA was used as template for preparing the sequencing library using 5’ multiplex PCR as previously described.31 The PCR products corresponding to the library amplification were purified on BluePippin with size cutoff around 500 bp ...
-
bioRxiv - Microbiology 2023Quote: ... 300 bp-insert RNA-seq Illumina libraries were constructed using ∼1.0 μg of enriched mRNA that was fragmented then used for synthesis of strand-specific cDNA using the NEBnext Ultra Directional RNA Library Prep Kit (NEB-E7420L). The cDNA was purified between enzymatic reactions and the size selection of the library performed with AMPure SpriSelect Beads (Beckman Coulter Genomics) ...