Labshake search
Citations for New England Biolabs :
201 - 250 of 10000+ citations for Human Hypoxia inducible factor 3 alpha HIF3A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... The mixture was incubated at room temperature for 10 min followed by transformation into 5-alpha competent cells (NEB). The E ...
-
bioRxiv - Microbiology 2020Quote: ... 2μL of the resulting mix was transformed into chemically competent Escherichia coli (High efficiency DH5-alpha, New England Biolabs) according to manufacturer’s instructions and cultured for 16 hours on Luria broth (LB ...
-
bioRxiv - Microbiology 2021Quote: ... and npmA F and npmA_R, respectively (Table S5) Assembled vectors (Figs. S4C, S4D) were transformed into NEB 5-alpha (New England Biolabs), selecting for ampicillin and gentamicin resistance ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Each library was split in two and transformed separately into 5-alpha cells (NEB, 3.5uL DNA in 35uL cells). Plasmid library isolation ...
-
bioRxiv - Microbiology 2019Quote: ... in conjunction with the NEBNext® rRNA Depletion Kit for Human/Mouse/Rat (New England BioLabs, Ipswich, MA, USA) and the MICROBExpress kit (Invitrogen ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... Leishmania DNA (0.0017 ng/μL) was then enriched from the human DNA (25ng/μL) using NEBNext Microbiome DNA Enrichment Kit (NEB) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: mRNA was enriched from 100ng DNase treated total RNA using the NEBNext rRNA depletion Kit (human, mouse, rat, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... A 140-500 ng aliquot of total RNA was rRNA depleted using NEB’s Human/Mouse/Rat RNAse-H based Depletion kit (New England BioLabs). Following rRNA removal ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2019Quote: The DNA oligo i116 that served as a 3’ adapter was adenylated using 5’ DNA Adenylation Kit (NEB), purified by ethanol precipitation as above and diluted to 10 μM with nuclease-free water.
-
bioRxiv - Molecular Biology 2023Quote: CDKN1A intron 1 APA 3’ splice site was deleted using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) as per the manufacturer’s instructions using forward primer (5’-TCCCCACCCCAAAATGACGCGCAGCC-3’ ...
-
bioRxiv - Genomics 2023Quote: ... CBS 112042+ and CBS 124.78+ were sequenced on R9.4.1 flowcells using the LSK108 kit with 3 μg DNA as input for the end prep reaction (NEB ULTRA-II EP ...
-
bioRxiv - Cell Biology 2023Quote: Ifnb1 mRNA 3’ UTR (NM_002176.4) was synthesized using the HiScribe T7 High Yield RNA synthesis kit (NEB, E2040S) through in vitro transcription ...
-
bioRxiv - Genomics 2024Quote: ... 3.) Library preparation was performed using the NEBNext Ultra II library preparation kit for Illumina (New England Biolabs) and 4. ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Genomics 2021Quote: ... The reactions were combined and 2.5 μL of the assembly reaction or a control reaction without amplicon were used to transform NEB5-alpha cells (New England Biolabs) to measure background assembly ...
-
bioRxiv - Biochemistry 2022Quote: ... The following cloning strains were used: NEB Stable (lentiviral and piggybac vectors) and NEB 5-alpha (all other plasmids) (New England Biolabs). For cloning of base editor constructs ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids carrying the dcas9/lacI cassette were recovered and propagated in the NEB 5-alpha F’ Iq strain (New England Biolabs). Cloning and/or propagation of plasmids containing the dcas9/lacI cassette in host E ...
-
bioRxiv - Molecular Biology 2022Quote: ... following the manufacture’s protocol. Plasmids were transformed in DH5-alpha or DH10-beta chemo-competent Escherichia coli (E. coli) cells (New England Biolabs). Transformed bacteria were grown in LB medium supplemented with 50 μg/mL kanamycin or 100 μg/mL carbenicillin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Cell Biology 2020Quote: ... Full-length 265 nt 5’ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Molecular Biology 2021Quote: ... Library preparation from human islets total RNA (200ng) was performed using a NEBNext Low Input RNA Library Prep kit (NEB). Sequencing was performed on a HiSeq4000 using 75 bp paired end reads according to Illumina specifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length 265 nt 5′ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Developmental Biology 2020Quote: ... We previously generated a human LRP5-V5 plasmid [32] and we used the Q5 site-directed mutagenesis kit (New England Biolabs) with forward primer (CTCAATGGCACATCCCGG ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... We then cloned a 2:1 molar excess of our gel-extracted insert into 100 ng of the human STARR-seq vector (linearized with AgeI and SalI) with the NEBuilder HiFi DNA Assembly Cloning Kit (NEB), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and Illumina linker addition to B cell heavy chain transcripts were performed using the human NEBNext Immune Sequencing Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... rRNA depletion was performed using a NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and RNA was purified using Agencourt RNAClean XP Beads (New England Biolabs). Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... W165F and S169A) were introduced into human PSEN1 cDNA cloned into the pMSCVpuro vector using Q5 Site-Directed Mutagenesis Kit (NEB BioLabs) according to the standard protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned N-terminally to human CISD1 and point mutations introduced by site-directed mutagenesis using the Q5 Site-Directed Mutagenesis kit (NEB). All plasmids were sequence verified ...
-
bioRxiv - Cell Biology 2023Quote: ... was inserted into murine Shh between amino acids 92N and 93T (corresponding to N91 and T92 in human Shh) by using Gibson assembly (HiFi Assembly Kit, NEB). Where indicated ...
-
bioRxiv - Bioengineering 2022Quote: ... Then CaCl2 was added to 2mM and 1 µL (about 1 µg) of Factor Xa (NEB) was added per 50 µg of protein and the samples were left at RT for 20-24h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Customized PURExpress reconstituted systems lacking all amino acids and release factors (Δaa, ΔRF123) (New England Biolabs) (Fig ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Cancer Biology 2023Quote: ... a DNA adapter (TableS6) was ligated to 3′ ends of nascent RNA using the T4 RNA ligase kit (NEB) by mixing 50 pmol adapter with 300-600 ng nascent RNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... mixed in a ratio 1:3 (insert:backbone plasmid) and ligated with T4 ligase according to manufacturer’s instructions (Quick Ligation kit, NEB M2200). The ligation reaction was transformed into competent TOP-10 bacteria and plated on agarose plates with Ampicillin ...
-
bioRxiv - Systems Biology 2024Quote: ... human (E6320, New England Biolabs, USA) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Placenta (M0307, New England Biolabs) and 25 U of M-MuLV Reverse Transcriptase with corresponding buffer (M0253 ...
-
bioRxiv - Genetics 2019Quote: ... coli was performed using DH5-alpha or its commercial derivative NEB 10-Beta (New England Biolabs product number C3019I or C3020). Genomic DNA of BY4741 ...
-
bioRxiv - Microbiology 2019Quote: ... Colonies were selected using a gentamycin marker and blue/white colony screening in a background of dH5-alpha cells (New England Biolabs, UK). The resulting construct was transformed into PA14 and the clone used for assays was verified by Sanger sequencing (University of Sheffield ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (fhuA2∆(argF-lacZ)U169 phoA glnV44 ϕ 80∆(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17) (New England Biolabs) was used for the initial two-plasmid assay ...
-
bioRxiv - Immunology 2021Quote: Point or deletion mutations were prepared from human or mouse CRT expression clones in pCMV3-C-Myc (SinoBiological) using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s protocol and primers designed using the NEBaseChanger™ web tool ...
-
bioRxiv - Systems Biology 2020Quote: ... rRNA depletion and library preparation for sequencing was completed with the NEBNext protocol (‘Protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries were prepared according to the protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) ...