Labshake search
Citations for New England Biolabs :
251 - 300 of 1198 citations for Human Carboxypeptidase M CPM Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Lambda protein phosphatase (New England BioLabs, P0753S) was used per product instructions.
-
bioRxiv - Pathology 2021Quote: Magnetic protein G beads (New England Biolabs) were blocked in antibody selection buffer and used to immobilize 10-15μg polyclonal rabbit anti-VWF (Dako A0082 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were degraded using proteinase K (NEB) and RNA was purified using RNeasy maxi kit (Qiagen).
-
bioRxiv - Biochemistry 2022Quote: ... Prestained protein ladders (P7712 or P7719, NEB) on the membranes were annotated by WesternSure Pen (LI-COR).
-
bioRxiv - Developmental Biology 2022Quote: ... EnGen Spy Cas9 NLS protein (NEB, M0646) was used for F0 experiments.
-
bioRxiv - Microbiology 2023Quote: ... coli Protein Synthesis System (New England Biolabs), then purified with Ni-NTA beads (Qiagen ...
-
bioRxiv - Genetics 2023Quote: ... gRNAs and Cas9 protein (NEB, cat# M0251S) were simultaneously injected into the embryos at one-cell stage.
-
bioRxiv - Microbiology 2024Quote: ... coli protein synthesis system (New England Biolabs) was used for in vitro protein expression ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein A magnetic beads (New England Biolabs) were saturated with rabbit-anti-GFP ...
-
bioRxiv - Cell Biology 2021Quote: Whole cell lysates or eluted proteins after affinity purification were treated with Protein Deglycosylation Mix II (NEB, Cat# P6044), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... so the bead-bound proteins were dephosphorylated in wash buffer containing 1:50 Lambda Protein Phosphatase (New England Biolabs) and 1 mM MnCl2 to make the phosphosites more accessible for a kinase assay ...
-
bioRxiv - Microbiology 2022Quote: ... Deglycosylation of purified protein was performed in non-denaturing conditions according to manufacturer’s protocol (Protein Deglycosylation Mix II, NEB).
-
bioRxiv - Genetics 2021Quote: ... 1 μg of RNA was reverse transcribed in cDNA using random hexamers and M-MuLV reverse transcriptase (New England Biolabs). Quantitative PCRs were assembled with Absolute QPCR ROX Mix (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... human emerin was first fused to the C-terminus of a SNAP tag by AscI and XhoI insertion in a pSNAP-tag(m) plasmid (NEB). SNAP-emerin was then subcloned into a modified pFUW lentiviral vector by NheI and AgeI insertion ...
-
bioRxiv - Molecular Biology 2021Quote: A CD22 cDNA fragment encoding the first two Ig-like domains fused to an EK-hIgG-Fc fragment was amplified by PCR and cloned into the mammalian expression vector pACP-tag(m)-2 (New England Biolabs).
-
bioRxiv - Molecular Biology 2019Quote: ... Complementary DNA (cDNA) was synthesized from total RNA of all different time points with M-MuLV Reverse Transcriptase (NEB, M0253S) by following the manual of the manufacturer ...
-
bioRxiv - Genomics 2021Quote: ... end repair was carried out with a mixture of bead-immobilized T4 DNA polymerase and T4 polynucleotide kinase (both kind gifts of Dr. M. Xu, New England Biolabs) in a 20 µl volume of End Repair buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were labelled with 2.5 μM (0.5 μM for dSTORM imaging) SNAP-Surface Alexa Fluor 546 or 647 (indicated as SNAP546 and SNAP647 in this study) (NEB) for 20 min and optionally counterstained with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Immunology 2021Quote: ... Two restriction sites NheI at the 5’ end and BamHI at the 3’ end were incorporated into the CD4-polypeptide linker plasmid which was then inserted into pACP-tag(m)-2 plasmid (New England Biolabs) to obtain pACP-CD4 ...
-
bioRxiv - Microbiology 2021Quote: ... VN173 fused to NiV-M was generated by exchanging Ub from the previously described VN173-Ub (Pentecost et al., 2015) for NiV-M using the Gibson Assembly Cloning Kit (New England BioLabs). MeV-M BiFC constructs were made by exchanging NiV-M fused to VN173 or VC155 for MeV-M using the Gibson Assembly Cloning Kit (New England BioLabs) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from 1 μg of total RNA using M-MuLV Reverse Transcriptase and Random Primers 6 (both New England Biolabs) at 42 °C for 60 min and diluted in 1:4 ratio by PCR grade water ...
-
bioRxiv - Microbiology 2020Quote: ... single-stranded cDNA was synthesized from 10 µg of RNA using 100 pM random hexamer primer (Integrated DNA Technologies) and M-MuLV Reverse Transcriptase (New England Biolabs). After reverse transcription ...
-
bioRxiv - Biochemistry 2022Quote: ... accordingly to manufacturer’s instructions and 1 μg of RNA was reverse-transcribed into cDNA using M-MuLV reverse transcriptase (New England Biolabs) and random hexamers ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA chimera was then cloned into the pACP-tag (m)-2 vector (addgene# 101126) using NheI and NotI (NEB) as the restriction sites ...
-
bioRxiv - Molecular Biology 2019Quote: 100µM of the synthesized phosphopeptides (Aapptec) or non-phosphorylated peptides were incubated with 350units of recombinant GSK3β (New England Biolabs) and cold kinase buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... First strand cDNA synthesis was performed for one hour at 42 °C using M-MuLV Reverse Transcriptase (New England Biolabs). Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’ ...
-
bioRxiv - Bioengineering 2019Quote: ... First-strand cDNA was synthesized using a random hexamer primer and M-MuLV reverse transcriptase (RNase H-; New England Biolabs). Second-strand cDNA synthesis was subsequently performed using DNA polymerase I and RNase H ...
-
bioRxiv - Molecular Biology 2019Quote: ... the RNA was mixed with 10 µM of custom 5’ adapter and the ligation reaction was done using T4 RNA ligase 1 (M0437M, NEW ENGLAND BIOLABS) and with RNasin Plus ...
-
bioRxiv - Biophysics 2019Quote: ... final products were separated from non-ligated fragments by electrophoresis using a 0.8-1.5% (m/V) agarose gel and extracted from the gel with the Monarch® DNA Gel Extraction Kit (NEB).
-
bioRxiv - Developmental Biology 2022Quote: ... using 200-300 ng of purified RNA as template and Moloney Murine Leukemia Virus (M-MuLV) Reverse Transcriptase (M0253, NEB). cDNA was synthesised using the standard first strand synthesis protocol with random hexamers (S1230 ...
-
bioRxiv - Cell Biology 2022Quote: ... treatment on the total RNA was performed and cDNAs were generated using the M-MuLV Reverse Transcriptase and random primers (NEB), as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... We generated cDNA with random hexamers for qRT-PCR) or oligo(dT) primers for RT-PCR using M-MLV (NEB). We carried out semi-quantitative RT-PCR using DreamTaq (Thermo Fisher) ...
-
bioRxiv - Physiology 2023Quote: ... was obtained by reverse transcription (RT) using 1 μg of RNA and Moloney murine leukaemia virus (M-MuLV) reverse transcriptase (M0253, NEB), using the first strand cDNA synthesis standard protocol with random primers (S1330 ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized from 1 μg of RNA using the ProtoScriptTM M-MuLV Taq RT-PCR kit and random primers (New England BioLabs). Quantitative PCR using SYBR select master mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reduced and alkylated samples were then diluted by adding 70 μL of 50 mM ABC (so that the final urea concentration was 5.5 M) and 20 ng/μL of LysC (New England Biolabs, P8109S) to each sample ...
-
bioRxiv - Neuroscience 2024Quote: ... a ∼1500bp genomic sequence flanking the Ten-m start codon (∼750bp each side) was amplified using the Q5 hot-start high-fidelity DNA polymerase (New England Biolabs) and inserted into the pCR-Blunt-TOPO vector (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purified human gDNA was digested with the restriction enzyme HaeIII (NEB, Ipswich, Massachusetts) per the manufacturer’s instructions to yield an average of 347-bp DNA fragments22 ...
-
bioRxiv - Genomics 2019Quote: ... mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA, USA). E14 genomic DNA was extracted with a DNeasy Blood and Tissue Kit (QIAGEN ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... Human FBP1 mutants were constructed by Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) in the PCDH-V5-FBP1 vectors ...
-
bioRxiv - Biophysics 2022Quote: Recombinant wild-type human histone H1.0 was used (H1; New England Biolabs M2501S). ProTαC and unlabeled ProTα were prepared as previously described (26) ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated for 30 minutes shaking at 1.500 rpm at room temperature with protein extract (500 µg of whole cell protein extract or 150 µg of CPE) and murine RNase Inhibitor (NEB) in the corresponding protein extraction buffer (without glycerol) ...
-
bioRxiv - Biophysics 2019Quote: ... uncleaved fractions and 3C protease were removed by Ni-chelated sepharose and the G protein was dephosphorylated by lambda protein phosphatase (NEB), calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: 750000 cells were harvested and resuspended in 40 μL lambda protein phosphatase reaction buffer (1X NEBuffer Pack for Protein MetalloPhosphatases (NEB), 1mM MnCl2 (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... was expressed as maltose-binding protein-tagged fusion protein using the pMAL(tm)c5X-vector (New England Biolabs, Ipswich, USA). The coding DNA sequence was amplified by PCR using gene-specific primers (for primer sequences ...
-
bioRxiv - Plant Biology 2021Quote: The MBP-NbERF-IX-33a fusion protein was prepared using the pMAL Protein Fusion and Purification System (New England Biolabs). E ...
-
bioRxiv - Plant Biology 2020Quote: ... and an aliquot containing 10 µg protein was treated with lambda protein phosphatase reaction mix following the instructions of the manufacturer (New England Biolabs) for 1 h at 30°C.
-
bioRxiv - Cell Biology 2019Quote: ... were expressed as fusion proteins with an N-terminal maltose binding protein (MBP)-tag using the pMALTMc5x-vector (New England Biolabs). Cloning was mediated by the addition of the restriction sites XmnI/PstI to the ends of gene fragments PCR-amplified from P ...
-
bioRxiv - Plant Biology 2023Quote: ... The MBP-OsTLP protein or the MBP control protein was bound to amylose resin (New England Biolabs, Beverley, MA, USA), and then the LssaCA-His protein was added to the beads ...
-
bioRxiv - Plant Biology 2024Quote: ... An aliquot containing 10 mg of protein was then subjected to lambda protein phosphatase reaction mix following the manufacturer’s instructions (New England Biolabs, US) for 1 hour at 30°C ...