Labshake search
Citations for New England Biolabs :
201 - 250 of 499 citations for Human Apolipoprotein AI B Free Serum since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: Mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA), and XP12 phage DNA was obtained from Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Microbiology 2020Quote: ... 0.8 mg ml-1 bovine serum albumin (BSA, New England Biolabs GmbH), 0.2 mM of each dNTP (Bioline ...
-
bioRxiv - Genomics 2021Quote: ... 12 μL of 10 mg/mL Bovine Serum Albumin (100× BSA, NEB), 5 μL of 400 U/μL T4 DNA Ligase (NEB M0202) ...
-
bioRxiv - Microbiology 2020Quote: ... 1.25 µl of 20,000 ng/µl bovine serum albumin (New England Biolabs), and 7.125 µl of molecular grade water ...
-
bioRxiv - Biochemistry 2022Quote: ... and further passivated with 2 mg/ml Bovine serum albumin (BSA, NEB:B9000S) to prevent non-specific binding of proteins and DNA to the surface ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with 1% Bovine Serum Albumin (BSA, New England Biolabs, B9000S) in PBST for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... 0.1 µg/µl bovine serum albumin (New England Biolabs, Pickering, ON, Canada), and 30 ng of DNA ...
-
bioRxiv - Immunology 2020Quote: ... 2.5 μl bovine serum albumin (BSA) (New England Biolabs, Ipswich, MA USA) and 2.5 μl dimethyl sulfoxide (DMSO ...
-
bioRxiv - Systems Biology 2022Quote: CAM-modified tryptic digest of bovine serum albumin (New England BioLabs Inc.) was labeled with dimethyl using the in-solution labeling protocol (Boersema et al ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 µg/µl bovine serum albumin (New England Biolabs, Pickering, ON, Canada), 30 ng of DNA template ...
-
bioRxiv - Genomics 2023Quote: ... 12 μL of 10 mg/mL Bovine Serum Albumin (100 × BSA, NEB), 5 μL of 400 U/μL T4 DNA Ligase (NEB #M0202) ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were expressed as N-terminal His6-Smt3 fusion constructs from either pET28-b vectors (expressed in T7 Express lysY/Iq (NEB) Escherichia coli (E ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the clpP2 gene were amplified by PCR using the A–B and C–D primer pairs from table 3 (Phusion polymerase, GC buffer, New England Biolabs). The PCR products were purified with E.Z.N.A ...
-
bioRxiv - Biochemistry 2021Quote: ... 700 bp upstream and downstream were amplified using the A–B and C–CD primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs). The 2×myc tag was added to the B primers as overhangs ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were resuspended in 1 ml of iCLIP lysis buffer B (same as buffer A but with 1% v/v NP-40 and 11 μl of Murine RNase inhibitor (NEB) per 1 ml ...
-
bioRxiv - Immunology 2022Quote: ... ligated in EcoRI-digested pCCLc-MND-X (A kind gift from Dr. Donald B. Kohn) and transformed using NEB-5alpha cells (NEB). Inserts were verified using MND_Input_Verify_F and MND_Input_Verify_R ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from IgG1 stimulated B cells 72 hour post-stimulation using TRIzol reagent (Fisher) and cDNA was prepared using the Protoscript II kit (NEB). Germline transcription was analyzed using quantitative PCR with SYBR Green (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... The entry module pGG-B-AtU6-26-BRI1-2-C and pGG-A-AtU6-26-BRI1-3-B were generated by annealing oligos for each gRNA and ligating into BbsI-digested (New England Biolabs) Golden Gate entry vectors described in (66) ...
-
bioRxiv - Microbiology 2023Quote: ... and a 1848 bp fragment (containing the 1131 bp Pfcytb open reading frame) was amplified with primers (SI Appendix, Fig. S2A,B) and Phusion DNA polymerase (NEB). PCR product was verified by gel electrophoresis as single band of predicted size ...
-
bioRxiv - Microbiology 2023Quote: ... These PCRs were performed with the specified primer sets (a, c and e or b, d and f) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Type I-F Cascade was co-expressed with 6xHis-MBP-TEV-TniQ and a type III-B crRNA in NiCo21 cells (NEB). Cells were then induced with 0.5 mM isopropyl at 18 °C for another 18–20 hours before harvesting ...
-
bioRxiv - Neuroscience 2024Quote: ... a V5 tag was inserted after the start codon of Ten-m cDNA (isoform B) in the plasmid pUAST-attB-Ten-m5 using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the UAS-V5-Ten-m-ΔICD and UAS-V5-Ten-m-ΔECD constructs ...
-
bioRxiv - Biophysics 2024Quote: ... The gene fragments were individually cloned into sensor plasmid backbones identical to those used in the previous identification of non-functional TetR(B) mutants following the manufacturers protocol for Gibson Assembly (New England Biolabs). The newly constructed plasmids carrying each of the combined mutants were then transformed into E ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... treated ~2 μg RNA with RNase-free DNase I (Catalog# M0303S NEW ENGLAND Biolabs, USA), then used 1 μL treated RNA in cDNA synthesis with SuperScript III Reverse Transciptase (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... The total RNA was then treated with RNase-free DNase I (New England BioLabs Inc.), and column purified using ISOLATE II RNA Mini Kit (Bioline ...
-
bioRxiv - Genetics 2020Quote: Oligonucleotide libraries were re-suspended in nuclease-free water and amplified by emulsion PCR (NEB Q5 polymerase ...
-
bioRxiv - Plant Biology 2021Quote: The extracted RNA was treated with RNase-free DNase (New England Biolabs, Ipswich, MA, USA). Quality control measurements were performed on a 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Plant Biology 2021Quote: ... the extracted RNA was treated with RNase-free DNase I (New England Biolabs, https://www.neb.com) for 30 min at 37°C ...
-
bioRxiv - Plant Biology 2021Quote: ... the extracted RNA was treated with RNase-free DNase I (New England Biolabs, https://www.neb.com) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... Ribosomes were added to 100 nM to the PURExpress ribosome-free kit (New England Biolabs) (29) ...
-
bioRxiv - Genetics 2022Quote: ... Then the reaction was diluted to 50µL and 2µL RNase-free DNase I (NEB, M0303S) were added ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 pmol of label-free RNA substrates were dephosphorylated with Alkaline Phosphatase (New England Biolabs) and labeled with [γ-32P] ATP (PerkinElmer ...
-
bioRxiv - Microbiology 2023Quote: cDNA was synthesized from DNA-free RNA using random nonamers (New England BioLabs, Ipswich, MA) and SuperScript III RT (Invitrogen/ThermoFisher ...
-
bioRxiv - Biochemistry 2020Quote: GQES7-a and GQES7-b were synthesized in vitro by transcription (HiScribe™ T7 High Yield RNA Synthesis Kit; New England Biolabs). GQes3 and mutes3 ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... (fhuA2 [lon] ompT gal (lambda DE3) [dcm] ΔhsdSlambda DE3 = lambda sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5) (New England Biolabs, C2527I) were used ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purified human gDNA was digested with the restriction enzyme HaeIII (NEB, Ipswich, Massachusetts) per the manufacturer’s instructions to yield an average of 347-bp DNA fragments22 ...
-
bioRxiv - Genomics 2019Quote: ... mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA, USA). E14 genomic DNA was extracted with a DNeasy Blood and Tissue Kit (QIAGEN ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... Human FBP1 mutants were constructed by Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) in the PCDH-V5-FBP1 vectors ...
-
bioRxiv - Biophysics 2022Quote: Recombinant wild-type human histone H1.0 was used (H1; New England Biolabs M2501S). ProTαC and unlabeled ProTα were prepared as previously described (26) ...
-
bioRxiv - Microbiology 2021Quote: ... and sometimes included up to 0.01 mg/mL bovine serum albumin (B9000S, NEB) to limit enzyme adsorption to pipettes and tubes ...
-
bioRxiv - Microbiology 2022Quote: ... and 300 ng bovine serum albumin (BSA; New England BioLabs Inc. Ipswitch, MA), to which nuclease-free H2O was added to reach a volume of 25 µl ...
-
bioRxiv - Genomics 2020Quote: ... 10 µL of 2% bovine serum albumin (New England Biolabs, cat. no. B9000S), 0.3 µL of 1M spermine (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5 µl 10 mg/ml bovine serum albumin (BSA; New England Biolabs Ltd.), 1 µl T4 DNA ligase (2000U ...
-
bioRxiv - Microbiology 2023Quote: ... 0.464 μg/μL bovine serum albumin (BSA, New England BioLabs Inc. Ipswich, Massachusetts), and 1.5 mM of MgCl2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA templates for the gRNAs were generated by a template-free Phusion polymerase (New England Biolabs) PCR reaction using a common scaffold primer (gRNA scaffold ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared using the NEBNext Ultra™ II PCR-free kit (New England Biolabs). In short ...