Labshake search
Citations for New England Biolabs :
1 - 50 of 771 citations for Human Anti NT5E Recombinant Antibody clone Hu101 28 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant human histone H4 (New England Biolabs # M2504S) was used as a substrate ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Recombinant human Histone H2A (New England BioLabs, Catalog # M2502S) or H4 (New England BioLabs ...
-
bioRxiv - Biochemistry 2022Quote: ... with recombinant proteins (200-500 ng) and yeast purified CK2 or recombinant human CK2 (NEB, P6010S). Proteins were resolved by SDS-PAGE and the gels were exposed to autoradiography or stained with Coomassie blue.
-
bioRxiv - Biochemistry 2020Quote: 1 μg of human recombinant histone H4 (BioLabs, Cat# M2504S) was incubated with 50 μM n-butyryl- or isobutyryl-CoA and 0.2 μM of HAT1 at 30 °C for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... recombinant human Furin (New England Biolabs Inc., Ipswich, MA, USA) was diluted in PBS and added to assays as indicated at a concentration of 10 U/ml ...
-
bioRxiv - Biophysics 2020Quote: Recombinant wild-type human histone H1.0 (New England Biolabs, cat. # M2501S) was used for experiments with fluorescently-labeled nucleosomes ...
-
bioRxiv - Biochemistry 2021Quote: Recombinant human CHIP was expressed in BL21(DE3) (New England Biolabs) E ...
-
bioRxiv - Cell Biology 2024Quote: ... coli-derived recombinant human histone H1 (NEB, Ipswich, MA, USA #M2501), H2A (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Biophysics 2022Quote: Recombinant wild-type human histone H1.0 was used (H1; New England Biolabs M2501S). ProTαC and unlabeled ProTα were prepared as previously described (26) ...
-
bioRxiv - Cancer Biology 2022Quote: Codon-optimized sequences encoding the DNA-binding domains of human BATF (AA 28-87) and JUNB (AA 269-329) were cloned into pMAL-C2X (NEB). The sequence encoding human IRF4 DBD (AA 19-120 ...
-
bioRxiv - Plant Biology 2021Quote: Ni pull down experiments were performed using 3μl of His tagged OsSRT1 constructs (0.3μg/ul) and 1μg recombinant human Histone H3 (NEB) and mixed with 20 μl of Ni-NTA slurry (Qiagen) ...
-
bioRxiv - Genomics 2023Quote: ... +28 μl M.EcoGII at 5 U/μl (NEB M0603S). The DNA was purified using Qiagen PCR columns and quantified by measuring A260 ...
-
bioRxiv - Genomics 2023Quote: ... (2) +28 μl Dam at 8 U/μl (NEB M0222L); (3 ...
-
bioRxiv - Biochemistry 2023Quote: ... mouse monoclonal antibodies against PAR (clone 10H, Tulip BioLabs, USA), anti-mouse antibodies conjugated with horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1 h at room temperature before being incubated with 1.0 µg/mL of recombinant human histone H3.1 (New England Biolabs, #M2503S) or GST-fusion proteins for 1 h at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... Recombinant Albumin (NEB), streptavidin (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: The cDNA sequences of the paired variable heavy and light chain region of anti-RBD antibody clones were synthesized as gBlocks (IDT) and cloned by the Gibson assembly (NEB) into human IgG1 heavy chain and light chain expression plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: ... and murine lung slices were incubated overnight with primary antibodies in 0.1% BSA as follows: anti-CDH1 (clone EP700Y, Biozol, 1:250) or anti-CDH1-Alexa-488 (clone 24E10, New England Biolabs, 1:50), anti-Twist1 (clone Twist2C1a ...
-
bioRxiv - Microbiology 2022Quote: ... Institut Jacques Boy), recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and DNase (1 U/ml, New England Biolabs), washed and enumerated ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human ADAMTSL2 constructs where generated by PCR-amplification with the Q5 Hot start high fidelity 2x master mix (NEB) and specific primer pairs to allow for restriction cloning ...
-
bioRxiv - Cell Biology 2024Quote: ... and 200 μM each of dATP/dCTP/dTTP at 21°C for 10 min and an additional 15 min incubation with 25 nM recombinant human RPA (a gift from Sarah W. Cai) and 0.03 U/μl T4 DNA polymerase (NEB, #M0203) at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and Dnase I (1 U/ml, New England Biolabs). Cells were washed and 5-9 x 106 PBMCs were then seeded/well in a 24-well plate in IMDM supplemented with 10 % SAB ...
-
bioRxiv - Cancer Biology 2024Quote: ... or rabbit anti human HMGA2 (New England Biolabs), ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Neuroscience 2022Quote: All anti-tau monoclonal antibodies were generated by the hybridoma approach against recombinant tau aggregates (human full-length tau) encapsulated in the ACM Polymersomes (ACM Biolabs, Singapore) and purified by size exclusion chromatography (SEC ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Cas9 protein (NEB) and sgRNA prepared by in vitro transcription were added to the mixture and incubated at 37℃ for ∼ 4h to remove rRNA ...
-
bioRxiv - Systems Biology 2024Quote: ... 28 cycles) using the Phusion® High-Fidelity PCR Master Mix (NEB, M0531L). Samples were verified using gel electrophoresis ...
-
bioRxiv - Immunology 2023Quote: ... via recombinant neuraminidase (NEB P0720L) as described by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 28 μl 10 x NEB DpnII buffer and 500 units of DpnII (NEB, R0543M) was added ...
-
bioRxiv - Cancer Biology 2024Quote: ... 28 novel RNF43 RING domain variants were generated using Q5 mutagenesis (New England Biolabs). All ZNRF3 and RNF43 expression plasmids were full-length sequence verified ...
-
bioRxiv - Plant Biology 2021Quote: ... and anti-MBP antibodies (NEB), respectively.
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibodies (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (NEB).
-
bioRxiv - Physiology 2022Quote: ... Recombinant CK2 was purchased from NEB. Recombinant TGFBR1 was purchased from Proqinase ...
-
bioRxiv - Bioengineering 2022Quote: Recombinant Cas9 (New England Biolabs, USA) was used to generate a standard curve (20µM ...
-
The ATP-dependent protease ClpYQ degrades cell division proteins DivIVA and Mbl in Bacillus subtilisbioRxiv - Biochemistry 2024Quote: ... 0.1 mg/mL recombinant albumin (NEB), 0.2 mM of dNTPs (NEB) ...
-
bioRxiv - Immunology 2021Quote: Point or deletion mutations were prepared from human or mouse CRT expression clones in pCMV3-C-Myc (SinoBiological) using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s protocol and primers designed using the NEBaseChanger™ web tool ...
-
bioRxiv - Cancer Biology 2022Quote: ... antibody and anti-Gluc antibody (New England Biolabs, ref. E8023).
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Genomics 2021Quote: A standard 28 base methylated hairpin oligonucleotide (CTGCCAGGATCTTTTTTGATCCTGGCAG) is provided by the manufacturer (New England Biolabs) at 15 µM ...
-
bioRxiv - Neuroscience 2023Quote: Specificity of anti-H3K9Me3 was tested against two types of substrates: recombinant histone H3 (New England BioLabs, M2507S), which lacked methylation ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-MBP murin monoclonal antibody (Biolabs) was immobilized (around 11000 responsive units (RU) ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-Kcr antibody (PTM Biolabs, PTM502), anti-Ub antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2021Quote: ... SET8 recombinant enzyme (New England Biolabs # M0428S) was incubated with recombinant active PARP1 (Trevigen # 4668-100-01 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3µl recombinant AsiSI endonuclease (10U/µL, NEB) was added to three biological replicates and incubated (2 h ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.2 mg/mL recombinant albumin (NEB B9200S), 1 μM RT primer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and recombinant shrimp alkaline phosphatase (rSAP, NEB) overnight and PCR purified (Qiagen QIAQuick PCR Purification Kit ...