Labshake search
Citations for New England Biolabs :
651 - 700 of 973 citations for Hepatitis C Virus Core Antigen HCcAg since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... MCC libraries were generated by digesting the chromatin in low Ca2+ MNase buffer (10 mM Tris-HCl pH7.5, 10 mM CaCl2) for 1 h at 37°C with MNase (NEB, M0247) added in varied concentrations (17-19 Kunitz U) ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were incubated for 45 min at 37°C and then transferred to a tube containing the ligation reaction (160 µL NEB ligation buffer 10X ...
-
bioRxiv - Microbiology 2022Quote: ... gDNA fragments were ligated with annealed adaptors overnight at 16 °C in the presence of T4 DNA ligase (NEB#M0202). Bands from 200 to 400 bp were selected by extraction from a 2% agarose gel using a Monarch DNA Gel Extraction Kit (NEB#T1020L) ...
-
bioRxiv - Molecular Biology 2019Quote: ... First strand cDNA synthesis was performed for one hour at 42 °C using M-MuLV Reverse Transcriptase (New England Biolabs). Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’ ...
-
bioRxiv - Molecular Biology 2019Quote: ... Proteins were pre-incubated at 4°C for 30 min before addition of 100 uL equilibrated amylose resin (New England BioLabs). The mixture was incubated for 1h at 4°C ...
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: ... 1 unit of λ-phosphatase is defined as the amount of enzyme that hydrolyzes 1 nmol of p-nitrophenyl phosphate in 1 minute at 30°C (New England Biolabs). After 45 minutes of incubation ...
-
bioRxiv - Biophysics 2019Quote: ... and 15-25 μM of BG-oligonuculeotides were labeled with ∼ 1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2019Quote: A total amount of 20 µg genomic DNA was digested overnight at 37°C with 100 U EcoRV or XbaI or BamHI or HindIII (New England Biolabs) in independent reactions ...
-
bioRxiv - Genomics 2019Quote: ... LB plates at 10-fold dilutions to 1/10,000 and grown overnight at 37°C and the remainder of the cells were left in SOC (New England Biolabs) at 4°C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... followed by heat inactivation for 10 min at 80°C and overnight ligation at a 1:3 vector-to-insert ratio using T4 DNA Ligase (NEB) at 4°C ...
-
bioRxiv - Genomics 2019Quote: ... were annealed to form adapters by incubating at 85°C for 10 min in 1x T4 DNA ligase buffer (NEB) before cooling gradually by transferring the heated block to the bench before dilution in 1x T4 DNA ligase buffer to working concentrations.
-
bioRxiv - Genetics 2019Quote: ... DNA samples were incubated at 20°C for 4h without rotation in a mix of 10 µl of 10x NEB2 buffer (New England Biolabs), 1 mM of a dNTPs mix (10 µl) ...
-
bioRxiv - Biochemistry 2019Quote: ... Those fractions containing the protein of interest were pooled and incubated 30 minutes at 4°C with pre-equilibrated amylose resin (New England BioLabs) and eluted with elution buffer (30 mM HEPES pH 8.0 ...
-
bioRxiv - Systems Biology 2020Quote: Digested DNA was heated to 50° C for 5 minutes to melt paired sticky ends then put into a 200 μL Klenow fragment (exo-, NEB) fill-in reaction containing 36 μM biotin-14-dCTP (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... The treated RNA samples were incubated with 100 μM RNA rP5_RND oligo (final 10 μM, Table S3) 2h at 25°C with 10 Units of T4 RNA ligase 1 (NEB). Please note that we used an RNA oligo ...
-
bioRxiv - Cancer Biology 2020Quote: ... eluted in 8 μl and in vitro transcribed (with the beads) at 37 °C overnight for linear amplification using the T7 High Yield RNA polymerase IVT kit (NEB). Following IVT ...
-
bioRxiv - Biochemistry 2020Quote: ... SMN-Gemin2 complex was produced by co-expression of SMN (residues 1-294) and Gemin2 (12-280) fused to a C-terminal Mxe intein (NEB) containing a hexahistidine tag ...
-
bioRxiv - Biochemistry 2020Quote: ... Hartmann Analytic) for 30 min at 37°C in 50 µl volumes with 20 units of T4 PNK (New England Biolabs) in the provided reaction buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... Inserts were then incubated for 1 hour at 37°C in the presence or absence of SssI methylase (New England BioLabs). The efficiency of the methylation reaction was verified by resistance to cleavage by the methylation-sensitive restriction enzyme HpaII (New England BioLabs) ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial lysis was completed by incubating for 3 h at 55°C in the presence of 1% SDS and 100 μg/ml proteinase K (NEB). Lysates from both methods were extracted twice with equal volumes of phenol– chloroform–isoamyl alcohol (25:24:1) ...
-
bioRxiv - Biophysics 2021Quote: ... and 15–25 μM BG-oligonuculeotides were labeled with ∼1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... chromatin from both IP and ‘Input’ samples were eluted and de-crosslinked at 65°C for 16 hours followed by DNA isolation by PCR and DNA cleanup kit (NEB). Enrichment of AR and MED1 at specified enhancers were quantified by qPCR using specific primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR of 10 cycles with an annealing temperature 61°C was performed using Q5 High-Fidelity DNA Polymerase (#M0491S, New England Biolabs) and BEL and AL primers on 5μL of I-SceI digested DNA purified from the ChIP procedure ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... were fused to the fluorescent protein mNeonGreen with a C-terminal linker and cloned into pJBL044 under the constitutive promoter Pveg using Gibson assembly (New England Biolabs). The original pJBL044 plasmid was constructed using isothermal assembly from a fragment of pDR160 (Bose and Grossman 2011) ...
-
bioRxiv - Microbiology 2021Quote: ... and cloned to the C terminus of a 11 His-tagged maltose-binding protein in a pMAL-C5X vector (New England Biolabs) separated by a cleavage site for tobacco etch virus protease ...
-
bioRxiv - Cancer Biology 2020Quote: ... was stored at 20° C or amplified immediately in 50 μl reactions with high-fidelity 2X PCR Master Mix (New England Biolabs) using a common forward primer and different reverse primers with unique barcodes for each sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Region B or Region C were used as templates for in vitro transcription by HiScribe T7 quick high yield RNA synthesis kit (NEB). The obtained RNA products were converted back to DNA oligo probes via reverse transcription (RT ...
-
bioRxiv - Biophysics 2021Quote: ... Two experiments were conducted in which the vacuum filling of the channels with buffer was followed by a heating/diffusion step of 1 hour at 40°C with the reservoir filled with a solution containing both DNase I (at 0.096U/μl) and BSA (NEB B9000S) at 0.13mg/ml or 0.40mg/ml ...
-
bioRxiv - Genomics 2019Quote: ... samples were digested with 10 U pshAI in 1x CutSmart buffer at 37°C for 3 or more hours (NEB).
-
bioRxiv - Molecular Biology 2019Quote: ... 100 pmol of the oligonucleotides 5’-ATTGTCATACCGATCCCAATTCGA-3’ and 5’-AAACTCGAATTGGGATCGGTATGAC-3’ were phosphorylated for 30 min at 37 °C using 1 mM ATP and 1 unit polynucleotide kinase (NEB) in the buffer supplied by the manufacturer and then hybridized in a thermocycler (5 min 95 °C ...
-
bioRxiv - Biophysics 2019Quote: ... gels were gently removed from the chamber and digested overnight at 37 °C in 8 units mL−1 Proteinase K (NEB) diluted in digestion buffer (1× TAE buffer ...
-
bioRxiv - Genomics 2020Quote: ... and half of the DNA was 3’-end labeled for 1 h at 37 °C in a 10-μl reaction containing 6 units of terminal deoxynucleotidyl transferase (New England Biolabs), 0.25 mM CoCl2 ...
-
bioRxiv - Biochemistry 2020Quote: ... at 95°C for 5 min and incubated with 80000 units of O-glycosidase and 100 units of neuraminidases for 4 hours at 37°C following the NEB kit protocol (E0540S; NEB). Samples were resolved on 15% Tris-tricine SDS-PAGE gel and blotted using anti-Cterm OCN goat antibody.
-
bioRxiv - Genomics 2021Quote: ... “Fuorf_RNA_adapter” was ligated to the 3’ end of 10 μl of cDNA in a 20 μl reaction at 65 °C for 1 hour using Thermostable 5’ App DNA/RNA ligase (New England Biolabs). The reaction was inactivated at 95 °C for 3 minutes and 2 μl of the reaction was used as a template for PCR for sequencing library generation as described below.
-
bioRxiv - Cell Biology 2021Quote: ... The β1 Integrin-HaloTag-GFP without ARL13B–C terminus (I-GFP) was generated by Q5 site directed mutagenesis (New England Biolabs).
-
bioRxiv - Cell Biology 2020Quote: ... Protein expression was induced with 0.3 mM IPTG for 2 hours at 37°C and recombinant MBP-rabaptin5 was purified with an amylose resin (New England Biolabs) according to manufacturs instructions and dialysed against lysis buffer (20 mM Tris-HCl ph7.4 ...
-
bioRxiv - Cell Biology 2019Quote: ... 95°C for 10 minutes and equal amounts of lysates (180 ug) were treated with either 1uL of EndoH (NEB), PNGase F (NEB) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Biochemistry 2020Quote: ... eluted protein samples may be treated with TEV protease at 4 °C overnight before flowing through Amylose resin (New England Biolabs) for a second step of affinity purification ...
-
bioRxiv - Genomics 2020Quote: ... Zyagen samples were amplified with PBC096 barcoding for 8-10 cycles with both LongAmp (female, 62°C annealing; NEB, US) and PrimeSTAR GXL (male and female ...
-
bioRxiv - Genomics 2019Quote: ... One million nuclei aliquots were pelleted by 1,000 x g at 4°C for 10 min and resuspended in 200 µl of GpC methyltransferase M.CviPI (NEB M0227L) reaction containing 1X GC Reaction Buffer ...
-
bioRxiv - Immunology 2020Quote: For recombinant CARD proteins, NLRP1 constructs (985-1473, 1213-1473, 1374-1466, 1374–1473) with or without C-terminal SNAP tag (NEB), CARD8–CARD (451-537 ...
-
bioRxiv - Microbiology 2021Quote: ... 200 ng ΔVC1807::ErmR transforming DNA was added and reactions were incubated at 30 °C for 10 minutes before the addition of 10 units of DNAse I (NEB) to prevent additional DNA uptake ...
-
bioRxiv - Microbiology 2020Quote: ... was linearized in a 500 μL reaction volume containing 100 units of ApaLI enzyme for 4-6 hours at 37°C in CutSmart buffer (New England Biolabs). The DNA was then ethanol precipitated as previously described (76) ...
-
bioRxiv - Microbiology 2020Quote: ... The pKAS32 vector was restriction digested using SacI and XbaI at 37°C for 1 hour followed by an additional 30 minutes at 37°C with alkaline phosphatase from calf intestine (CIP) (New England Biolabs). Vector backbone and upstream and downstream segments were joined using Gibson assembly (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR reactions were pooled and treated for 1 hour at 37°C with 250 u /ml of Exonuclease I (NEB). Libraries were purified using NucleoSpin Gel and PCR Clean-up (Macherey-Nagel) ...
-
An egg-derived sulfated N-Acetyllactosamine glycan is an antigenic decoy of influenza virus vaccinesbioRxiv - Immunology 2021Quote: ... 25 ug of the 2020 QIV was denatured for 10 minutes at 75°C and treated with the Protein Deglycosylation Mix II (New England Biolabs) for 30 minutes at 25°C and 1 hour at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: Pre-miR-181a-1 DNA template was obtained by two oligos (sequence below) after annealing and elongation at 12°C using 25U T4 DNA polymerase (NEB). The DNA template was purified with NucleoSpin PCR Clean-up kit (Macherey-Nagel) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Each PCR amplification product was digested overnight at 37 °C with 2 μl of CutSmart® uffer (New England Biolabs) and 0.2 μl of AccI enzyme (10 U/mL ...