Labshake search
Citations for New England Biolabs :
401 - 450 of 483 citations for Hantaan Virus Nucleoprotein HEK293 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 2 mM CaCl2 was added and the His8 tag was cleaved through the addition of 8-16 U/mL enterokinase (New England Biolabs) for 2 days at 37°C ...
-
bioRxiv - Genetics 2021Quote: Plasmid pNR127.9 was constructed by changing the first rfk-1 stop codon in pNR9.1 from TAG to TGG with primer set 1727/1728 and the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Similarly ...
-
bioRxiv - Microbiology 2021Quote: ... the coding sequence of MS2V5 was removed from pCI-MS2V5-eRF3a F76a plasmid and an N-terminal FLAG tag was inserted to the same plasmid by PCR and re-circularized using NEBuilder HiFi DNA Assembly Master Mix (NEB). The F76a mutation was mutated back to wildtype using In-fusion cloning (Clontech).
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Immunology 2020Quote: For recombinant CARD proteins, NLRP1 constructs (985-1473, 1213-1473, 1374-1466, 1374–1473) with or without C-terminal SNAP tag (NEB), CARD8–CARD (451-537 ...
-
bioRxiv - Molecular Biology 2021Quote: To tag the molecular end, HMW genomic DNA (gDNA, see above) was first A-tailed using terminal transferase (NEB M0315) in a reaction by incubating 2ug of gDNA ...
-
bioRxiv - Biochemistry 2022Quote: MBOAT7 mutants were generated by site-directed mutagenesis on the pFBM construct expressing MBOAT7 with a C-terminal GFP and strep tag using the Q5 Mutagenesis Kit (New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing an N-terminal 6xHis tag and TEV site was produced in Escherichia coli NiCo21 (DE3) cells (New England Biolabs) as previously described in https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6069193/ ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Microbiology 2022Quote: ... which was assembled with oligo DNA containing Myc or FLAG tag sequence using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). The resultant plasmids were named pcDNA3-C-Myc or pcDNA3-C-FLAG ...
-
bioRxiv - Microbiology 2022Quote: ... we amplified the gene ctl0382 (homolog of ct127) with a six histidine tag in the reverse primer using Phusion enzyme (NEB), and the PCR product was linked with pBOMBL::L2 linearized by EagI and KpnI using HiFi assembly system (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The yrbA-fs15 DNA templates (with TAG or TGA stop codons) used for in vitro transcription/translation reactions in the classic PURExpress system (New England Biolabs) were prepared by PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... pCIG2-SNAP-M87 (generated for this study from pCIG2-GFP-MACF43 by replacing GFP with SNAP-tag from pSNAPf vector (New England Biolabs) and MACF43 with M87 from pCMV-Tag/WT M87) ...
-
bioRxiv - Biochemistry 2023Quote: ... following the manufacturer’s protocol and adapting the IMPACT (Intein Mediated Purification with an Affinity Chitin-binding Tag) System (NEB # 6901S). The human eIF2A coding sequence was cloned into the C-terminal Mxe GyrA Intein-chitin-binding domains (CBD ...
-
bioRxiv - Plant Biology 2023Quote: AtXRCC4 fused to a hexa-histidine followed by a GST tag (pGAT3-atxrcc4) was expressed in BL21(DE3) cells (NEB), The proteins were purified using GST sepharose (Cytiva) ...
-
bioRxiv - Microbiology 2023Quote: ... encoding a C-terminal myc tag were cloned into NcoI and HindIII sites of pHERD20T-myc and pHERD30T-myc using Gibson Assembly (NEB) or Hifi Assembly (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... A TEV protease cut site preceding the 6x histidine tag was previously introduced using the Q5 Site-Directed Mutagenesis Kit from NEB and the GeneJET Plasmid Miniprep Kit from ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... Specific forward primer targeting E1 and a reverse primer targeting the nongenomic tag were used in 20 ul SYBR Green reaction with 1x Luna qPCR Dye (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng Golden Gate vector (pcDNA3-based carrying a twin Strep-FLAG tag, synthesized by BioCat, Heidelberg, Germany) 2 U BSA HFv2 (NEB), 1 U T4 ligase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... with an N-terminal human CD33 signaling peptide and C-terminal 12xHis purification tag was codon optimized and ordered as a gBlocks Gene Fragment (IDT) with overhangs for Gibson assembly (NEB). The sequence was engineered to have a single Cys in the EC5 domain for site-specific labeling as previously described11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was amplified from afp18-3CTS with primers including a stop codon before the tag and closing the linear fragment using the KLD enzyme mix from New England Biolabs (NEB). Positive clones were confirmed with colony PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Coli vectors expressing SAHS proteins without SUMO tags were ordered and synthesized from Twist Bioscience and transformed into LEMO21(DE3) competent cells (NEB). To test for the effects of intracellular SAHS expression ...
-
bioRxiv - Biophysics 2023Quote: ... The full length KIF5B in pACEBac1 was replaced with a C-terminal TEV-Twin-Strep-tag via HIFI DNA assembly kit (NEB). The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395 ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCR8[mZC3H18] plasmid was used as a template to generate subsequent ZC3H18 cDNA constructs that were cloned into a piggyBAC (pB) vector containing an N-terminal MYC tag and BSD selection marker using NEBbuilder HiFI DNA assembly (NEB). OsTIR1-HA ...
-
bioRxiv - Biochemistry 2024Quote: ... C-terminal mEGFP-tag and HSP18 terminator for assembly into pICSL86955 using BsaI (ThermoScientific) restriction enzyme and T4 DNA ligase (New England Biolabs). The GoldenGate restriction-ligation-reaction was transformed into E ...
-
bioRxiv - Genomics 2019Quote: ... The DNA (50-100 ng) was amplified using the Phusion Hi-Fi PCR master mix with HF buffer (New England Biolabs M0531) or the Q5 Hot Start HiFi PCR master mix (New England Biolabs E6625AA ...
-
bioRxiv - Cell Biology 2020Quote: ... was performed using 10ng of His tagged PTP-PEST (WT) plasmid as template and followed by Dpn1 (New England Biolabs, UK) digestion for 2 hours at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were then divided into two aliquots and treated with and without 100 U M.CviPI GpC methyltransferase (100 U/million cells; New England Biolabs, M0227B-HI) supplemented with fresh 160 μM S-adenosyl-L-methionine for 15 min at 37ºC ...
-
bioRxiv - Cell Biology 2023Quote: ... were combined using a the NEBuilder Hi-Fi DNA assembly kit according to the manufacturer’s instructions (E5520, New England BioLabs, Waltham, MA). The resulting product was transformed into then transformed into competent cells (C2987 ...
-
bioRxiv - Cell Biology 2023Quote: ... These fragments were combined using a the NEBuilder Hi-Fi DNA assembly kit according to the manufacture’s instructions (E5520, New England BioLabs, Waltham, MA). The resulting product was transformed into then transformed into competent cells (C2987 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Biochemistry 2024Quote: ... Truncated EWSR1 constructs were created by PCR-based cloning from the His-MBP-EWSR1 expression vector using inverse PCR with Phusion DNA polymerase (New England Biolabs, F530S) then DpnI digest (New England Biolabs ...
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A FLAG surface tag was C-terminally appended to MxEnc and QtEnc using Q5® Site-Directed Mutagenesis (New England Biolabs). QtEncFarn was generated by appending a minimal C-terminal farnesylation signal (GCMSCKCVLS ...
-
bioRxiv - Biochemistry 2022Quote: ... The library was cloned into a pENTR1A plasmid backbone with a C-terminal YFP HA reporter tag using Gibson Assembly (HiFi DNA Assembly Cloning Kit, New England Biolabs, (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2022Quote: ... was cloned into pGex6P-1 in-frame with an N-terminal 3C-cleavable GST tag using HiFi assembly (New England Biolabs, USA).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by PCR and subcloned into pMRX-IP backbone vector together with the EGFP tag by Gibson Assembly (New England Biolabs, E2611L). All deletion and point mutation mutants of LC3B and GABARAP were generated by a PCR-based method.
-
bioRxiv - Molecular Biology 2022Quote: ... and BGH reverse (5’-TAG AAG GCA CAG TCG AGG -3’) primers from the pcDNA3.1+/-C-(K)-D vector using standard methods (NEB 2x Q5) which include 5-10 ng DNA per reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... A V5 tag was inserted before the stop codon by Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA, USA). Afterwards ...
-
bioRxiv - Bioengineering 2020Quote: ... and cloned into pET vector in frame with a C-terminal 6XHis tag by Gibson assembly (NEBuilder® HiFi DNA Assembly Master Mix, New England Biolabs). DNA encoding SARS-CoV-2 S RBD (S a.a ...
-
bioRxiv - Cell Biology 2022Quote: ... the sequence encoding amino acids 1-490 was amplified with NdeI and EcoRI overhangs and inserted into a modified backbone based on pSNAP-tag(T7)2 (NEB #N9181S) before a SNAPf-EGFP-6His tag (Budaitis et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Integration of the amplified mouse genomic DNA into the donor plasmid and integration of the 3x HA tag before the stop codon were each carried out by Gibson assembly (NEB, USA). HDR into C57BL/6J background mouse embryos was carried out by mixing the plasmid donor ...
-
bioRxiv - Developmental Biology 2023Quote: ... This plasmid was modified to include a C-terminal V5 tag using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). For arnt1-myc ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was incubated for 1 hour in the presence of an anti-SNAP-tag primary antibody (New England Biolabs #P9310S) diluted at 1:2000 in PBS + tween-20 0.1% ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated nucleotides from the non-ligated DNA ends were removed by incubating the Hi-C libraries (2 μg) in the presence of 6 U of T4 DNA polymerase (NEB; Cat#: M0203L) in NEBuffer 2.1 supplied with 0.025 mM dATP (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... The Hi-C library for Illumina sequencing was prepped by NEBNext® Ultra™ II DNA library Prep Kit for Illumina (NEB) according to manufacturer’s instructions ...