Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... EnGen Mutation Detection Kit (New England BioLabs) was used for amplification of target DNA ...
-
bioRxiv - Molecular Biology 2020Quote: Thermocycler was used to denature and anneal 5 µl of PCR product as recommended by manufacturer (EnGen™ Mutation Detection Kit, NEB, E3321S). Thermocycler was adjusted for heteroduplex formation as following ...
-
bioRxiv - Cell Biology 2022Quote: ... Editing efficiency was assessed using the EnGen Mutation Detection Kit (NEB) (E3321S ...
-
bioRxiv - Microbiology 2019Quote: ... The probe was detected by chemiluminescence using the Phototope-Star Detection Kit (NEB) and autoradiographic film ...
-
bioRxiv - Molecular Biology 2023Quote: ... Editing activity of α-synCas was evaluated using EnGen Mutation Detection Kit (NEB). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... GST-tagged proteins were purified on glutathione-Sepharose beads (New England Biolabs), and MBP-tagged proteins were purified on Amylose resin (New England Biolabs).
-
bioRxiv - Bioengineering 2020Quote: ... using fluorescent CoA 647 (NEB) as substrate ...
-
bioRxiv - Biochemistry 2023Quote: ... The array DNA was composed of a fluorescent nucleotide Alexa Fluor 647-aha-dCTP (ThermoScientific) and was generated using Klenow Fragment 3’ – 5’ exo- (NEB). Nucleosome arrays were mixed with SUV420H1 or 5μM HP1α and incubated at room temperature for 20 mins before transferring to a glass bottom 384 well plate for imaging ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl 5’Ligation Reaction Buffer (NEB-kit) and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Biophysics 2022Quote: ... Non-fluorescent RNA was transcribed using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, #E2040S). Following in vitro transcription by either kit ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... and detected using components based on the Phototope-Star detection kit (New England BioLabs, Cat# N7020). All T ...
-
bioRxiv - Biophysics 2023Quote: ... Following mutagenesis for fluorescent labeling and/or creating RTT mutations using the Q5 mutagenesis kit (New England BioLabs), plasmids were transformed into E ...
-
bioRxiv - Biophysics 2024Quote: ... and Monarch PCR&DNA Cleanup Kit (5 μg) (NEB). The purified dsDNA templates were transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Cell Biology 2024Quote: ... Fluorescent cell permeable Snap-Cell substrates (NEB) were used in the following concentrations ...
-
bioRxiv - Cell Biology 2020Quote: ... GST fusion protein on glutathione beads was incubated with 250 units CK2 (New England Biolabs) in protein kinase buffer (New England Biolabs ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit) followed by a 1 h incubation at 25°C ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-fusion proteins on glutathione beads were pre-treated with 250 units CK2 (New England Biolabs) in protein kinase buffer (New England Biolabs ...
-
bioRxiv - Bioengineering 2020Quote: ... we included LAMP Fluorescent Dye (New England Biolabs) as a general LAMP indicator ...
-
bioRxiv - Cell Biology 2019Quote: A construct expressing SURF4 and the Katushka2S fluorescent marker (PGK-SURF4-p2A-Katushka2S) was assembled with the NEBuilder HiFi DNA assembly cloning kit (NEB) using vector sequence derived from LV1-5 (Addgene #68411 ...
-
bioRxiv - Molecular Biology 2023Quote: ... by replacing the green fluorescent protein (GFP) with a mCherry reporter using the NEBuilding HiFi DNA Assembly Cloning Kit (New England Biolabs) (Ran et al. ...
-
bioRxiv - Bioengineering 2020Quote: ... The RT-PCR detection was conducted by using the Luna Universal One-Step RT-qPCR kit from NEB and following its protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA synthesis was visualized by detecting biotin with the Phototope-Star detection kit (New England Biolabs Ref N7020S) and images acquired on a Chemidoc system (Biorad).
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... with a cleavable Glutathione-S-Transferase (GST) tag at the N-terminus) and pMALTMc5X (New England Biolabs, USA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Microbiology 2021Quote: ... Sorted transduced cells were frozen down for later use or subjected to EnGen mutation detection kit (New England BioLabs) for on-target gene editing confirmation ...
-
bioRxiv - Immunology 2022Quote: ... 5µl of RNA (roughly corresponding to 1µg) was reverse transcribed to cDNA using the LunaScript RT SuperMix kit - dye based qPCR detection (NEB) following manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... 5µl of RNA (roughly corresponding to 1µg) was reverse transcribed to cDNA using the LunaScript RT SuperMix kit - dye based qPCR detection (NEB) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: 5’-Phosphorylated linker (Oligonucleotide K, Supplementary Table 6) was adenylated using a 5’ DNA Adenylation Kit (New England Biolabs) at 20x scale and purified by TRIzol extraction as previously described56 ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.3 µM fluorescent SNAP substrate (TMR Star, NEB, S9105) was added along with the primary antibodies
-
bioRxiv - Plant Biology 2021Quote: ... The glutathione S-transferase (GST) tag was cleaved using Factor Xa Protease (New England Biolabs, Ipswich, MA, USA) in accordance with the manufacturer’s instruction.
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Neuroscience 2022Quote: ... and oligos annealed with adapters to the sense 5’ - CACC and antisense 5’-AAAC were ligated using Quick Ligase Kit (New England Biolabs). Ligated product was transformed into stabl3 competent E ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NNN spacer to increase library diversity during sequencing (preadenylated oligos were prepared by 5’ DNA adenylation kit (E2610L) using thermostable 5’ App DNA/RNA ligase (M0319L, both from New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2021Quote: ... Indel frequencies at the SaCas9 target site were assessed via a T7E1 assay with the EnGen Mutation Detection Kit (NEB), using the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: ... The LAMP reaction in the 2-step LAMP-CRISPR detection was performed using the WarmStart® LAMP Kit (NEB #E1700), using primer concentration described in literature (“Rapid Detection of SARS-CoV-2 Using Reverse transcription RT-LAMP method,” 2020) ...
-
bioRxiv - Microbiology 2020Quote: ... The LPMO and CBH1 amplicons for detection were radio-labelled with [α-32P] dCTP using the NEBlot Kit (NEB, USA) according to the manufacturer’s instructions and used as a probe to determine the copy number of T-DNA integrations in all the transformants.