Labshake search
Citations for New England Biolabs :
1 - 50 of 261 citations for Genz 644282 CAS 529488 28 6 99% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... +28 μl M.EcoGII at 5 U/μl (NEB M0603S). The DNA was purified using Qiagen PCR columns and quantified by measuring A260 ...
-
bioRxiv - Genomics 2023Quote: ... (2) +28 μl Dam at 8 U/μl (NEB M0222L); (3 ...
-
bioRxiv - Genomics 2022Quote: ... the 1:99 target:background sample was digested with FspEI (New England Biolabs) according to the manufacturers protocol (incubation at 37°C for 90 minute ...
-
bioRxiv - Systems Biology 2024Quote: ... 28 cycles) using the Phusion® High-Fidelity PCR Master Mix (NEB, M0531L). Samples were verified using gel electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... 28 μl 10 x NEB DpnII buffer and 500 units of DpnII (NEB, R0543M) was added ...
-
bioRxiv - Cancer Biology 2024Quote: ... 28 novel RNF43 RING domain variants were generated using Q5 mutagenesis (New England Biolabs). All ZNRF3 and RNF43 expression plasmids were full-length sequence verified ...
-
bioRxiv - Genomics 2021Quote: A standard 28 base methylated hairpin oligonucleotide (CTGCCAGGATCTTTTTTGATCCTGGCAG) is provided by the manufacturer (New England Biolabs) at 15 µM ...
-
bioRxiv - Microbiology 2023Quote: ... All 3 fragments were amplified from pTRL2-His-GrgA (28) using Q5 DNA polymerase (New England Biolabs). Fragment 1 was generated using primers pgp3-pgp4-F and His-RBS-R (sTable 5) ...
-
bioRxiv - Evolutionary Biology 2022Quote: The DMRT regulatory region was amplified from the DMRT>GFP plasmid [28] using Phusion polymerase (New England Biolabs) with primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng total RNA in a volume of 9 μl was ligated to 1 μl custom adapter mix (18S:28S ratio 1:2) using 1.5 μl T4 DNA ligase (New England Biolabs) in NEB next Quick ligation buffer (3 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... were generated from previously described pcDNA3-FLAG-MS2-TTP plasmids (28) using site-directed mutagenesis according to manufacturer’s protocol (New England Biolabs). Expression plasmids for FLAG-tagged constitutive active and catalytically dead MK2 kinases were previously described (12 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... fixed nuclei resuspended in 171 uL SPBSTM were mixed with 99 uL NTP buffer and 30 uL T7 polymerase mix (New England Biolabs) and incubated in a 1.5 mL LoBind tube (Eppendorf ...
-
bioRxiv - Biophysics 2020Quote: ... It has been generated by PCR amplification from the pCTCF-GFP vector (28) and sub cloned into the pHalo-GR previously cut with PvuI and XhoI restriction enzymes (New England Biolabs). The pHalo-SMARCA4 was purchased from Promega (pFN21AE0798) ...
-
bioRxiv - Cancer Biology 2022Quote: Codon-optimized sequences encoding the DNA-binding domains of human BATF (AA 28-87) and JUNB (AA 269-329) were cloned into pMAL-C2X (NEB). The sequence encoding human IRF4 DBD (AA 19-120 ...
-
bioRxiv - Cell Biology 2023Quote: ... was introduced into an existing pZDonor-AAVS1-CAG-HA-KLF1-ERT2-PolyA plasmid (28) via site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... We subjected 100 ng of DNA to a first round of PCR (25-28 cycles, Q5 hot start high-fidelity DNA polymerase (New England Biolabs)) to amplify the locus of interest and attach common overhangs ...
-
bioRxiv - Microbiology 2021Quote: ... purple (6×) (New England Biolabs). Samples were loaded into a 4-15% precast polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primer 6 (NEB, #S1230S), RNasin Ribonuclease inhibitor (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... 6 U DNase-I (NEB) and 3 µL RNase A (NEB ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified HDAC insert and the expression vector pET-28 a(+) were digested with BamHI/XhoI restriction enzymes (New England Biolabs, UK), and were ligated over night at 16 °C using T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 μl of 10 mM MnCl and 6 μl (=2400 units) of Lambda phosphatase (#P0753, NEB). Dephosphorylation was carried out at 30°C for 30 minutes and stopped by addition of Roti Load buffer (#K929.1 ...
-
bioRxiv - Microbiology 2023Quote: ... and was subsequently inserted into a cloning vector pUCNDVH5 (28) by Phusion polymerase chain reaction (Finnzymes Phusion®, New England Biolabs®) (29) ...
-
bioRxiv - Genomics 2024Quote: ... and Random Primer 6 (NEB, S1230S). The samples were finally purified using AMPure XP Beads (Beckman Coulter Life Sciences ...
-
bioRxiv - Physiology 2022Quote: ... in zebrafish f5 proximal promoter sequences (Fig. 4E, Supplemental Table 5) (28) was conducted using a Q5 site-directed mutagenesis kit (NEB, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digests with 6 x loading dye (NEB) were run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 6 μl CutSmart Buffer (NEB, B7204) in a total volume of 60 μl for 3 hours at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 U Bst3.0 DNA polymerase (NEB) in total 15 μl reaction volume ...
-
bioRxiv - Microbiology 2020Quote: ... 6 mM MgSO4 (NEB, final 8mM Mg2+), 1.4 mM each dNTP (Enzynomics) ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 6 mM MgSO4 (100 mM stock, NEB), 0.32 U/μl NEB Bst 2.0 polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digest with 6 x loading dye (NEB) was run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U of Heparinase I (NEB) was added to the first strand cDNA synthesis mix ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 μl BST LF polymerase (NEB M0275L), and 36 μl DEPC-treated H2O ...
-
bioRxiv - Plant Biology 2024Quote: ... 6 µg of the commercial EngenCas9 (NEB) with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... 6 mM Magnesium Sulfate (MgSO4 – NEB #B1003), 1.4 mM deoxynucleotide (dNTP ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by PNGase A (NEB; pH 6). The released N-glycans were purified using initially a cation exchange material (Dowex AG50 H+ form ...
-
bioRxiv - Biochemistry 2024Quote: ... mixed with 6× DNA loading dye (NEB), and separated by agarose gel electrophoresis as in the DNA cleavage assays ...
-
bioRxiv - Microbiology 2020Quote: ... 6 µg of DNA was used for MmeI digestion in 200 µL (6 µg gDNA, 6 µL MmeI (2000 U/mL, NEB), 0.5 µL 32 mM S-adenosylmethionine ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A fraction (6 μL) of the eluate was mixed with an equal volume of 6× purple gel loading dye (NEB) and loaded in 1% agarose gel with ethidium bromide ...
-
bioRxiv - Immunology 2023Quote: ... was biotinylated with sulfosuccinimidyl-6-[biotinamido]-6-hexanamido hexanoate (sulfo-NHS-LC-LC biotin; ThermoScientific) and coupled to streptavidin beads (New England Biolabs). Patient samples were incubated with RBD-coupled beads and excess sera washed off with PBS (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 6 μl 10mM ATP (New England Biolabs). Linear DNA was then digested by 30 minute incubation at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... and 6 μM of random hexamer primer (NEB). cDNA was amplified with Taq DNA polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 6 μl 20 mg/ml BSA (NEB B9000S), and 5 μl of 400 U/μl T4 ligase (NEB M0202S/L) ...
-
bioRxiv - Microbiology 2022Quote: ... 6 U Bst 2.0 WarmStart DNA polymerase (NEB), and 2.25 U WarmStart® RTx Reverse Transcriptase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... 4 mM MgSO4 (NEB; final, 6 mM Mg2+), 1 mM each dNTP (Enzynomics) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U/ml Thermolabile proteinase K (NEB). The barcoded PAAm beads were prepared for encapsulation as previously described (Zilionis et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 6 μl of 50% PEG 8000 (NEB B1004A), 40 units of Ribolock RNase inhibitor EO0382)] ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µL of Proteinase K (New England Biolabs) was added to the cell resuspension ...
-
bioRxiv - Bioengineering 2024Quote: ... and 6 μL Quick CIP (New England Biolabs), and left to react for 3 h at 37 °C ...