Labshake search
Citations for New England Biolabs :
1 - 50 of 176 citations for Gamma secretase subunit APH 1B APH1B Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... gamma-mCherry or NaeI-EcoRV (NEB) pAG3-mCherry fragment containing proviral sequence ...
-
bioRxiv - Genomics 2021Quote: ... was generated by cloning in a P2A-HygroR (APH) cassette after dCas9-KRAB using Gibson assembly (NEB, E2611L). The lentiviral Grna expression plasmid was cloned by combining a U6-gRNA cassette containing the gRNA-(F+E)-combined scaffold sequence (60 ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was labeled with gamma-32P-ATP using T4 PNK (NEB). After washing with PNK buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... Atg13-SNAP used in Figure 1B was supplemented with the SNAP-Surface Block (New England BioLabs) after labeling.
-
bioRxiv - Neuroscience 2020Quote: ... a catalytic subunit of protein kinase A (PKA Cα, New England Biolabs); Ca2+/calmodulin-dependent protein kinase II (CaMKII ...
-
bioRxiv - Biochemistry 2023Quote: ... and DDRGK1207-305-UFL127-200 (corresponding to DDRGK1-UFL1ΔN in the main text) (Figure 1b) were generated using Gibson assembly (Gibson assembly master mix, New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR amplification was performed with primers targeting the indicated regions (Fig. 1B, Supplemental Table S1) using Taq DNA Polymerase (New England Biolabs) for 30 cycles of amplifying protocol ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1B) driving intestinal Pun-PGP-9 expression were assembled using the NEB HIFI DNA Assembly Kit (New England Biolabs Inc.) according to the manufacturer’s instructions into the supplied pUC19 vector linearized by SmaI (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribosomes with a spytag labeled L17 subunit was used during in vitro translation system (NEB, E3313S) to generate the stalled RNC ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and tRNA-Gly-CCC (Table S1) were radioactively labeled with gamma-32P-ATP using T4 PNK (NEB). Pre-hybridization and hybridization were performed in OligoHyb Buffer (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... Table 4 was end labeled using gamma-ATP and T4 Polynucleotide Kinase radioactive labeling protocol from NEB. Labelled oligos were purified using GE Healthcare illustra ProbeQuant G-50 Micro Columns and the membrane was probed overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... To perform in vitro phosphorylation 5 μg of purified GST-NL2CT (WT or S714D) fusion protein was incubated with 2.5kUnits purified catalytic subunit of PKA (NEB) supplemented with 200 μM ATP at 30°C for the indicated time points.
-
bioRxiv - Biochemistry 2021Quote: ... cDNAs encoding each of the CBAF subunits were PCR-amplified using Phusion DNA polymerase in HiFi Phusion buffer (NEB) and subcloned into pLibMam vectors using NEBuilder HiFi (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Trx-linker concatemers (1 mg/mL) were incubated with 50,000 units of the catalytic subunit of cAMP-dependent protein kinase (PKA) (NEB)—which recognizes the RRAS motif within the central linker of the Trx-linker nonamer—in protein kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 4.1 μl of PLPPR3 ICD (final concentration 0.075 mg/ml) was mixed with 0.2 μl purified PKA catalytic subunit (final concentration 20 000 Units; #P6000S, Biolabs), 0.8 μl phosphorylation buffer (final concentration of 25 mM HEPES ...
-
bioRxiv - Neuroscience 2024Quote: ... All TARP and AMPA subunit cDNAs were subcloned into pcDNA3.1(+) by PCR amplification with high-fidelity Q5 polymerase (New England Biolabs) using primers with restriction sites in the overhangs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Oligos (20 pmoles) were labeled at their 5’ ends using gamma-32P-rATP (3000 Ci/mmole) and polynucleotide kinase (New England Biolabs), and purified on 7M urea ...
-
bioRxiv - Biochemistry 2024Quote: ... When relevant cmpRNA (500 pmol) was 5’-end phosphate-32 “hot” labeled using fresh gamma phosphate-32 labeled ATP (50 nmol) and PNK (NEB) following the producer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... proteolytic subunits were removed from the expression constructs using blunt end deletion following a standard Q5 mutagenesis workflow (New England Biolabs). Additionally ...
-
bioRxiv - Microbiology 2024Quote: To test the binding affinity of the TBT and TBTG mRNA to the 30S ribosomal subunit we used PURExpress ΔRibosome Kit (NEB) supplemented with 5 μM of 30S ribosomal subunit and 10 μM tRNAfMet in the presence of 1.4 μM of radioactively labelled mRNA (prepared as described above by in vitro translation followed by [32P] labelling as described for the northern blot probe labelling) ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 200 µM ATP with ot without 1 µl of recombinant PKA catalytic subunit (PKAc; New England Biolabs) in manufacturer-supplied reaction buffer at 30° C for 30min with agitation ...
-
bioRxiv - Biophysics 2023Quote: ... To enrich for fully assembled TC-TL complexes the expressome was purified via immobilizing the 50S subunit (ZS22) onto streptavidin magnetic beads (NEB). For this ...
-
bioRxiv - Cell Biology 2021Quote: ... were subcloned into phCMV3 to express C-terminal FLAG-tagged CatSper subunits (phCMV3-CatSperd or z-Flag) using NEBuilder® HiFi DNA Assembly Kit (NEB). A stop codon was placed at the upstream of HA-encoding sequences of phCMV3 vector for FLAG-tagged CatSper subunit cloning.
-
bioRxiv - Neuroscience 2022Quote: ... The non-15N 4R tau used for small-scale chemical in vitro crosslinking was phosphorylated using cAMP-dependent Protein Kinase (PKA, catalytic subunit, New England Biolabs #P6000S) according to manufacturer guidelines (25uL reaction at 30°C for 2 hours with 200 μM ATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... antibody and anti-Gluc antibody (New England Biolabs, ref. E8023).
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Plant Biology 2021Quote: ... and anti-MBP antibodies (NEB), respectively.
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibodies (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (NEB).
-
bioRxiv - Cancer Biology 2024Quote: ... Bound antibodies were detected by incubation with DyLight 800-conjugated secondary antibodies (New England BioLabs), and analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-MBP murin monoclonal antibody (Biolabs) was immobilized (around 11000 responsive units (RU) ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-Kcr antibody (PTM Biolabs, PTM502), anti-Ub antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bound antibodies were detected by incubation with anti-rabbit DyLight 800-conjugated secondary antibody (New England BioLabs). Slides were analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...
-
bioRxiv - Molecular Biology 2021Quote: Myc-Tag (9B11) antibody (NEB 2276 S) and mouse IgG (Santa Cruz sc-2025 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-lactyllysine antibody (PTM Biolabs), or mouse monoclonal anti-β-actin antibody (A5316 ...
-
bioRxiv - Biochemistry 2020Quote: ... Anti-butyryllysine antibody (PTM BioLabs, PTM#301) at 1:2000 dilution was incubated with the membrane overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Biochemistry 2020Quote: ... Primary antibodies used were: New England Biolabs (NEB), Hitchin ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-MBP antibody (NEB E8032L; 1:10,000) in 1x TBST supplemented with 5% low-fat milk were incubated either at 4 °C overnight or 1 hr at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse antibodies against MBP (NEB E8032L, 1:20,000) were used to detect 2XMBP-tagged proteins and rabbit antibodies against HA (Cell Signaling C29F4 ...
-
bioRxiv - Cancer Biology 2024Quote: The rabbit anti-m6A antibody (#E1610S, NEB, U.S.A) was conjugated to Protein A agarose beads (Sigma ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 30 minutes in PBS containing the primary antibodies: rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs, Hangzhou, China), mouse monoclonal anti-tubulin β3 (801201 ...