Labshake search
Citations for New England Biolabs :
1 - 50 of 234 citations for GAPDH Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... or rabbit anti-GAPDH (2118S NEB, 1:5000) primary antibody with horseradish peroxidase-conjugated anti-mouse or anti-rabbit (Dianova 1:10,000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... or without 350 units of recombinant GSK3β (rabbit skeletal muscle) (New England BioLabs) and 1X hot kinase buffer (50mM Tris ...
-
bioRxiv - Molecular Biology 2022Quote: ... GAPDH -- Cytoplasm (NEB #2118), LAMIN A/C – Nucleus (NEB #4777) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Cas9 protein (NEB) and sgRNA prepared by in vitro transcription were added to the mixture and incubated at 37℃ for ∼ 4h to remove rRNA ...
-
bioRxiv - Immunology 2023Quote: ... via recombinant neuraminidase (NEB P0720L) as described by the manufacturer ...
-
bioRxiv - Physiology 2020Quote: ... GAPDH (#2118, 1:10000, Cell signalling, NEB, UK), alpha-tubulin (T5168 ...
-
bioRxiv - Biochemistry 2022Quote: ... with recombinant proteins (200-500 ng) and yeast purified CK2 or recombinant human CK2 (NEB, P6010S). Proteins were resolved by SDS-PAGE and the gels were exposed to autoradiography or stained with Coomassie blue.
-
bioRxiv - Bioengineering 2022Quote: Recombinant Cas9 (New England Biolabs, USA) was used to generate a standard curve (20µM ...
-
bioRxiv - Physiology 2022Quote: ... Recombinant CK2 was purchased from NEB. Recombinant TGFBR1 was purchased from Proqinase ...
-
bioRxiv - Molecular Biology 2021Quote: ... SET8 recombinant enzyme (New England Biolabs # M0428S) was incubated with recombinant active PARP1 (Trevigen # 4668-100-01 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3µl recombinant AsiSI endonuclease (10U/µL, NEB) was added to three biological replicates and incubated (2 h ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and recombinant shrimp alkaline phosphatase (all NEB) at 37°C overnight ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and recombinant shrimp alkaline phosphatase (rSAP, NEB) overnight and PCR purified (Qiagen QIAQuick PCR Purification Kit ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.2 mg/mL recombinant albumin (NEB B9200S), 1 μM RT primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H3 (Lys 23) mouse mAb (PTM Biolabs, SKU: PTM 307), Butyryl-Histone H4 (Lys 8 ...
-
bioRxiv - Genomics 2022Quote: ... and 30 nM recombinant Cas9 nuclease (NEB, M0386S) at 37°C for 2 hours ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg of recombinant H4 (New England Biolabs) and 100 μM S-adenosyl methionine (SAM ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant human histone H4 (New England Biolabs # M2504S) was used as a substrate ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 or 500 units of recombinant CK2 (NEB), 5µM or 15µM silmitaserib (CK2 inhibitor ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µL 1U recombinant shrimp alkaline phosphatase (NEB) and 2.5 µL 10x CutSmart buffer (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.1 mg/ml recombinant albumin (New England Biolabs), 0.1 mg/ml RNase A (QIAGEN) ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.1 mg/ml recombinant albumin (New England Biolabs), and 0.1 mg/ml RNase A (QIAGEN)] ...
-
bioRxiv - Genomics 2021Quote: ... The purified recombinant protein or commercial M.EcoGII (NEB, M0603S) was diluted with coating buffer (0.05 M NaHCO3 buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... This experiment was further repeated with recombinant Histones (NEB) (0.5µg ...
-
bioRxiv - Genetics 2020Quote: ... MEFs were protein transfected with recombinant RNase H (NEB) using Project Reagent Transfection Kit (Thermo ...
-
bioRxiv - Molecular Biology 2023Quote: ... a combination of both recombinant RBPMS and BSA (NEB). Splicing reactions were incubated for the 3 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20pmol of recombinant histone H3.1-H4 tetramer (NEB, M2509S) were immediately added to the tube ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Recombinant human Histone H2A (New England BioLabs, Catalog # M2502S) or H4 (New England BioLabs ...
-
bioRxiv - Immunology 2021Quote: Purified recombinant CV3-25 IgG was mixed with LysC (NEB) at a ratio of 1μg LysC per 10mg of IgG and incubated at 37°C for 18h with nutation ...
-
bioRxiv - Molecular Biology 2022Quote: ... recombinant kinases (2500 U/mg protein for PKA (NEB-P600S), 500:1 Tau:kinase for Gsk3ß (BPS-40007) ...
-
bioRxiv - Cell Biology 2022Quote: ... purified recombinant PKA proteins (2,500 units/ml, New England Biolabs) along with 100 μM cAMP ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of human recombinant histone H4 (BioLabs, Cat# M2504S) was incubated with 50 μM n-butyryl- or isobutyryl-CoA and 0.2 μM of HAT1 at 30 °C for 1 hour ...
-
bioRxiv - Developmental Biology 2020Quote: ... Kinase assays were performed using recombinant murine c-Abl (NEB). The amounts of GST-fusion protein to add to the reaction were calibrated using western blots of the purification products with mouse anti-NICD (1:1000 ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant hACE2 protein was digested using EndoH (New England Biolabs) and thrombin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... recombinant proteins were treated with PNGase F (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR-amplified recombinant DNA was treated with DpnI (NEB Biolabs) for 3 h ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR-amplified recombinant DNA was treated with DpnI (NEB Biolabs) for 3 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... or within GAPDH (GAPDH_RTPCR_F: TCACCAGGGCTGCTTTTAAC; GAPDH_RTPCR_R: ATCGCCCCACTTGATTTTGG) using Taq DNA Polymerase (New England BioLabs) with primer-specific annealing temperatures and cycle numbers (RPL22L1 ...
-
bioRxiv - Biophysics 2020Quote: Recombinant wild-type human histone H1.0 (New England Biolabs, cat. # M2501S) was used for experiments with fluorescently-labeled nucleosomes ...
-
bioRxiv - Bioengineering 2021Quote: Recombinant RfxCas13d proteins were expressed in E.coli NiCo21(DE3) (NEB C2529). Cells were grown in 1L of lysogeny (Luria-Bertrani ...
-
bioRxiv - Genetics 2019Quote: ... after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, USA), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... and dephosphorylated using recombinant shrimp alkaline phosphatase (New England BioLabs M0371L). Annealed and phosphorylated oligonucleotides were cloned into linearized and dephosphorylated BPK1520_puroR using T4 DNA Ligase (New England BioLabs M0202L ...
-
bioRxiv - Immunology 2021Quote: ... A similar dilution series of recombinant histone H3 (New England Biolabs) was prepared starting at 1 µg/ml protein ...
-
bioRxiv - Biochemistry 2021Quote: Recombinant human CHIP was expressed in BL21(DE3) (New England Biolabs) E ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 mM DTT with 1.5 µM recombinant H3 (New England Biolabs), vehicle or 500 nM recombinant enzyme ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant proteins were induced in SHuffle Express strains (New England Biolabs) upon addition of 1mM IPTG in cultures containing kanamycin 50 μg/mL and incubated with agitation at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant bacmids were created by transformation into DH10Bac competent cells (NEB), screening on XGAL plates ...
-
bioRxiv - Biochemistry 2024Quote: ... Protease Inhibitors) with recombinant PKA kinase (2500 U/mg, NEB-P600S) and 1 mM ATP overnight at 30°C and 250 rpm ...
-
bioRxiv - Cell Biology 2024Quote: ... coli-derived recombinant human histone H1 (NEB, Ipswich, MA, USA #M2501), H2A (NEB ...