Labshake search
Citations for New England Biolabs :
151 - 200 of 218 citations for FGF 8B Human Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... PCR products were purified and cloned into human-IgG (Heavy, Kappa or Lambda) expression plasmids32 using the Gibson Assembly Master Mix (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... W165F and S169A) were introduced into human PSEN1 cDNA cloned into the pMSCVpuro vector using Q5 Site-Directed Mutagenesis Kit (NEB BioLabs) according to the standard protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned N-terminally to human CISD1 and point mutations introduced by site-directed mutagenesis using the Q5 Site-Directed Mutagenesis kit (NEB). All plasmids were sequence verified ...
-
bioRxiv - Cell Biology 2023Quote: ... was inserted into murine Shh between amino acids 92N and 93T (corresponding to N91 and T92 in human Shh) by using Gibson assembly (HiFi Assembly Kit, NEB). Where indicated ...
-
bioRxiv - Biophysics 2023Quote: The RAMANK regions of the four human Notch paralogues (Table S3) were subcloned into the pMAL-c2x expression vector using HiFi DNA Assembly (New England BioLabs). Constructs were expressed in BL21(DE3 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 200 μM each of dATP/dCTP/dTTP at 21°C for 10 min and an additional 15 min incubation with 25 nM recombinant human RPA (a gift from Sarah W. Cai) and 0.03 U/μl T4 DNA polymerase (NEB, #M0203) at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-mouse IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) were used as the secondary antibodies.
-
bioRxiv - Developmental Biology 2023Quote: Regulatory elements were amplified from mouse genomic DNA with Q5 polymerase (NEB, M0491) using primers listed in Table S8 and cloned into pGL4.24[luc2P/minP] (Promega ...
-
bioRxiv - Biophysics 2021Quote: We produced the vector PB PGKp-PuroR L30p MCS-GDGAGLIN-HaloTag-3xFLAG by amplifying the human L30 promoter with prAH675 and prAH676 and assembling into AsiSI- (NEB R0630) and XbaI- (NEB R0145 ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA substrates for in vitro cleavage represent fragments of human mitochondrial DNA amplified by PCR in Q5® High-Fidelity 2X Master Mix (M0492L, NEB). As a template ...
-
bioRxiv - Biophysics 2021Quote: An in-frame fusion between the human 5-HT5AR from the Presto-Tango cDNA library (4) and the human Gαi1 was made via HiFi DNA assembly (New England Biolabs, Ipswich, MA). Mutations of key contact points between docked ligands and the human 5-HT5AR binding pocket were made via site-directed mutagenesis as directed (Stratagene ...
-
bioRxiv - Developmental Biology 2020Quote: A digoxin-labeled human H19X probe was transcribed in situ from a linear template plasmid by T7 RNA polymerase (NEB, UK) with Digoxin-labeled Uridine (Roche ...
-
bioRxiv - Biochemistry 2021Quote: ... per 1g of wet cell weight and 1 Unit of 30 Units/μL RNase Inhibitor (from human placenta; New England Biolabs (NEB), No ...
-
bioRxiv - Cell Biology 2021Quote: ... ORF was amplified from MCF10A human mammary cells using specific primers (listed in Table S2) with Q5 High-Fidelity 2X Master Mix (New England BioLabs, # M0492), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: All anti-tau monoclonal antibodies were generated by the hybridoma approach against recombinant tau aggregates (human full-length tau) encapsulated in the ACM Polymersomes (ACM Biolabs, Singapore) and purified by size exclusion chromatography (SEC ...
-
bioRxiv - Developmental Biology 2023Quote: Human and bovine XIST E repeats were PCR amplified from cDNA generated from either total RNA of Ishikawa (human) or bovine stromal cells (Supplementary Table S4) with the Q5 High-Fidelity DNA polymerase (NEB, UK) or the non-proofreading Taq DNA Polymerase (EP040 ...
-
bioRxiv - Molecular Biology 2023Quote: ... W165F and S169A) were introduced into human PSEN1 cDNA cloned into the pMSCVpuro vector using Q5 Site-Directed Mutagenesis Kit (NEB BioLabs) according to the standard protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids encoding mouse Nav1.2 (NP_001092768.1) and Nav1.6 (NP_001070967.1) were cloned by Gibson Assembly (NEB) with synthetic gBlocks gene fragments (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: Mouse phogrin was obtained from the IMAGE consortium (clone BC_133678) and CLIPf from NEB. The fusion protein was generated by standard molecular cloning techniques ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse Adnp was amplified from pENTR223.1-Adnp using Q5 High Fidelity DNA Polymerase (NEB) and primers containing 6xHis tag to insert it into the C-terminal region of Adnp ...
-
bioRxiv - Biophysics 2022Quote: PME measurements were carried out using a transient expression vector we created by inserting a synthetic gene block encoding the cDNA sequence of the human β2AR (Integrated DNA Technologies, Coralville, IA) into a modified pcDNA5 FRT using the NEBuilder kit (New England Biolabs, Ipswitch, MA). The final construct was designed to generate β2AR bearing an N-terminal influenza hemagglutinin tag from a transcript that also features a downstream internal ribosome entry site (IRES)-dasher GFP cassette that facilitates the unambiguous identification of positively-transfected cells ...
-
bioRxiv - Neuroscience 2020Quote: ... Methylation standards (100 % and 0 %) were either prepared by in vitro methylation of human genomic DNA using M.SssI CpG methyltransferase (NEB, Frankfurt a.M; Germany) or by whole-genome amplification using the REPLI-g Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid encoding GFP-labeled dominant negative mutant version of human Rab5B isoform was introduced to plasmid #1008 using Q5 Site-Directed Mutagenisis kit (NEB, Cat# E0554S) according to manufacturer’s instructions using forward primer #1554 (AGTGGGAAAGaacAGCCTGGTATTAC ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Biochemistry 2023Quote: ... or deletion of the mitochondrial targeting sequence (dMTS) of the human FAM210A coding sequence (CDS; Uniprot Entry # Q96ND0) region was amplified using Q5 DNA polymerase (NEB, Cat # M0491). The FAM210A DNA was inserted into 2Cc-T and 2CT-10 vectors using the Ligation Independent Cloning (LIC ...
-
bioRxiv - Genomics 2022Quote: For each of the two ligation-based protocols used for mouse sperm (Truseq, NEB Next), two replicate libraries for mouse sperm were prepared with the additional condition of an 18 hour ligation at 16°C for the ligation of the 3’ adapter in the attempt to increase ligation efficiency ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA (1 µg) extracted from adult mouse testes was treated with alkaline phosphatase (NEB), de-phosphorylated ...
-
bioRxiv - Immunology 2023Quote: ... for mouse was PCR-amplified and ligated into this vector via Gibson assembly (NEB, Cat# E2621S). The ligated product was precipitated ...
-
bioRxiv - Cell Biology 2019Quote: ... then incubated with either mouse anti-MBP antibodies at a dilution of 1:5000 (New England Biolabs) or 1:2500 mouse anti-GFP antibodies (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... The mouse C10 G54R mutation removes a cut site of the restriction endonuclease BanII (NEB, cat# R0119S), introducing a restriction fragment length polymorphism ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA isolated from lysed mouse aortic SMCs was digested with enzyme cocktail containing HindIII – XbaI – EcoRI (NEB). Following digestion ...
-
bioRxiv - Cancer Biology 2023Quote: Mouse NIK coding sequence in the pENTR shuttle plasmid was mutated using Phusion high fidelity polymerase (NEB) and oligonucleotides designed to carry the desired mutations (indicated by lowercase letters) ...
-
bioRxiv - Biochemistry 2023Quote: ... Bound protein was detected by western blot using mouse anti-MBP diluted 1:10,000 (New England Biolabs), fluorescent secondary antibodies (Li-Cor Biosciences) ...
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Bioengineering 2024Quote: ... Amplicons from mouse embryo lysates were generated using Q5 Hot Start High-Fidelity 2x Mastermix (M0492, NEB) in a 25 μL reaction ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Neuroscience 2022Quote: ... CREB (CCDS15005.1) and CRTC1 (CCDS40372.1) were amplified from mouse brain cDNA library by primers contain AgeI-HF (R3552L, NEB) and BamHI-HF (R3136L ...
-
bioRxiv - Neuroscience 2024Quote: Mouse Hapln1 (NM_013500) was cloned into the pAAV vector by PCR with the following primers and ligase (NEB) or In-Fusion cloning (Takara) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... elegans and mouse cDNA (PolyATtract® mRNA Isolation Systems, Promega and ProtoScript® First Strand cDNA Synthesis Kit, NEB). Detailed sub-cloning information is available upon request.
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...