Labshake search
Citations for New England Biolabs :
1 - 50 of 2192 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... the DNAs of one Jomon dog (MD1) and three late 8th century dogs (SWD_2, SWD_5, and SWD_7) were treated by USER enzyme (NEB) for uracil removal ...
-
bioRxiv - Biophysics 2022Quote: ... 1 µL factor mix (NEB), 250 nM pre-incubated 50S ribosomal subunits ...
-
bioRxiv - Biophysics 2022Quote: ... 2 µL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Biophysics 2023Quote: ... 1 μL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 1 µL factor mix (NEB), 250 nM MS2-tagged 50S ribosomal subunit ...
-
bioRxiv - Biochemistry 2024Quote: ... the concentrated protein at 3 mg/mL was incubated with c-AMP Protein Kinase A PKA (NEB) (molar ratio of 40:1 ...
-
bioRxiv - Biochemistry 2022Quote: 30 uL of tagged Fluc-WT proteins were incubated with Factor Xa (NEW ENGLAND BioLabs, final concentration 67 ug/mL) for 2 hours or overnight on ice.
-
bioRxiv - Biochemistry 2022Quote: In vitro protein translation was carried out (in absence of the release factors) using the PURExpress ΔRF123 kit (New England Biolabs). This guaranteed the stabilization of the ternary complexes mRNA-affitin-Ribosome ...
-
bioRxiv - Genomics 2024Quote: Each of the fragmented protein factor-enriched chromatin sample was mixed with 50 µg/ml of BSA (cat# B9000S, NEB) to prevent chromatin aggregation ...
-
bioRxiv - Biophysics 2020Quote: ... Factor Xa protease (New England Biolabs) was added to the MT solution at a molar ratio of 1 ...
-
bioRxiv - Plant Biology 2021Quote: ... Factor Xa (P8010S, New England BioLabs) or TEV protease (P8112S ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 µg factor Xa protease (NEB) and 5 mM CaCl2 with inversion at 10 °C overnight ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and a maltose binding protein (MBP) (65) and Factor Xa sequence derived from pMAL-c5X vector (New England Biolabs, Ipswich, MA) with a V313A mutation to be consistent with the native E ...
-
bioRxiv - Cell Biology 2021Quote: All dox-inducible factors were generated by cloning the open reading frame of each factor into the pMINI vector (NEB) and then restricted with EcoRI or MfeI and inserted into the FUW-TetO expression vector ...
-
bioRxiv - Neuroscience 2024Quote: ... and 16,000 units/ml lambda protein phosphatase at 30°C for 3 hours (New England Biolabs #P753S).
-
bioRxiv - Microbiology 2020Quote: ... the resin was treated with factor Xa protease (P8010L, NEB) overnight at 4°C ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... the MPB tag was cleaved overnight using Factor Xa (NEB) in dialysis buffer and loaded again on an MBP-Trap HP column ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Biochemistry 2021Quote: ... MBP was cleaved from LH using Factor Xa (New England Biolabs) at a w/w ratio of 1% Factor Xa:LH ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 20 µL of denatured protein lysate was combined with 2.5 µL of 10X GlycoBuffer 3 (Cat.#B1720S; New England Biolabs) and 2.5 µL of Endo Hf in a total reaction volume of 25 µL ...
-
bioRxiv - Microbiology 2024Quote: ... protein aliquots were subjected to PNGase F or a broad range mannosidase (α1,2/3/6) (New England Biolabs, France) digestion according to the manufacturer’s specifications ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Dephosphorylated RNA-protein complexes were then rinsed once with NT2 buffer and 3’-end ligated with T4 RNA Ligase 1 (NEB) overnight in an Eppendorf Thermomixer at 16°C ...
-
Suppressing STAT3 activity protects the endothelial barrier from VEGF-mediated vascular permeabilitybioRxiv - Molecular Biology 2020Quote: ... to a final concentration of 0.1µg/ml was incubated with 3 µg purified STAT3 proteins as well as 5 µl ATP (New England Biolabs; N0440S) for 30 minutes at 30°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 or Cas12a protein (NEB, Ipswich, MA) were mixed in reaction tubes as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Appropriate fractions were pooled and digested with factor Xa protease (New England Biolabs) in the presence of 2 mM CaCl2 at 4 °C overnight ...
-
bioRxiv - Synthetic Biology 2021Quote: 8.3 μM bdSUMO-HSPB611–20 fusion protein containing pSer or nhpSer at site S16 of HSPB6 were reacted with 3 units of λ phosphatase (NEB) according to manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Bioengineering 2020Quote: ... protease mutant S219V [24] was inserted at the 3’ end of gene encoding maltose binding protein (MBP) in pMAL-c5E vector (New England Biolabs, MA, USA) to construct pMAL-TEV vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... deglycosylation treatment (Dglyco) consisted of sample incubation for 3 hours at 37°C with 20 nL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per μL of sample ...
-
bioRxiv - Cell Biology 2023Quote: ... the column was loaded with 80 units of Factor Xa (New England Biolabs, P8010) in cleavage buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... activation was performed overnight at 4 °C with 5 μg of Factor Xa (NEB) per mg of protein ...
-
bioRxiv - Cell Biology 2024Quote: ... Assembly of each factor was done using NEB HiFi 2X mastermix (NEB Cat. No. E2621L) with 50 ng of digested backbone and 10-40ng of gel purified cDNA following standard protocol from NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Bioengineering 2022Quote: ... Then CaCl2 was added to 2mM and 1 µL (about 1 µg) of Factor Xa (NEB) was added per 50 µg of protein and the samples were left at RT for 20-24h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Customized PURExpress reconstituted systems lacking all amino acids and release factors (Δaa, ΔRF123) (New England Biolabs) (Fig ...
-
bioRxiv - Biochemistry 2024Quote: ... affinity-purified MBP-BTSL2-N-Strep was cleaved using Factor Xa protease (NEB, product no. P9010L) at a concentration of ∼2.8 ng/mL for 24 h at 4 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Systems Biology 2024Quote: ... and 3 μL of Klenow 3’ to 5’ exo (5 U/μL, NEB), and samples were incubated in a thermocycler at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... The bead slurry was directly treated with 3 µL Klenow (3’→5’ exo-) (NEB) in 50 µL NEB Buffer #2 with 0.2 mM ATP at 37 °C for 30 min to add 3’ overhangs to DNA ...
-
bioRxiv - Biophysics 2020Quote: ... and 3-biotin-GTP (NEB) and purified using MEGAclear ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 units of DNaseI (NEB) were added and the mixture was incubated at 37°C for 1 h.
-
bioRxiv - Microbiology 2020Quote: ... 3) NEB LongAmp (NEB M0287) and 4 ...