Labshake search
Citations for New England Biolabs :
1 - 50 of 348 citations for Dnp pro leu gly cys me his ala D arg nh2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... sfgfp was cloned in-frame with tssB and a short linker (encoding 3×Ala 3×Gly) by Gibson Assembly (New England Biolabs) into pNCC1-Spec to allow IPTG-inducible expression of TssB-sfGFP ...
-
bioRxiv - Plant Biology 2023Quote: ... without its Stop codon and with a Gly-Gly-Ser-Gly-linker at the 3’-end was first amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the primers GGB_OEP7_F – AACAGGTCTCAAACAATGGGAAAAACTTCGGGAGC and GGC_OEP7_GGSG_R – AACAGGTCTCTAGCCTCCAGATCCTCCCAAACCCTCTTTGGATGTGG ...
-
bioRxiv - Biophysics 2021Quote: ... was reacted with BG-NH2 (New England Biolabs) to produce the benzylguanine functionalised dye BG-CF640R ...
-
bioRxiv - Cell Biology 2023Quote: ... and BG-NH2 (New England Biolabs Inc., S9148S) (36 ...
-
bioRxiv - Cell Biology 2020Quote: BG-NH2 (New England Biolabs Inc., Ipswich, MA, USA) and NHS-Rho14 (ATTO-TEC GmbH ...
-
bioRxiv - Microbiology 2023Quote: ... a custom 3’ adapter (5ʹ-rAppCTGTAGGCACCATCAAT–NH2-3ʹ, NEB) was ligated to all RNAs following the protocol described in (91) ...
-
bioRxiv - Biophysics 2024Quote: ... 650 µM of BG-NH2 (New England Biolabs, S9148) was added to the mixture ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Systems Biology 2024Quote: ... and E.coli DH10B (NEB Labs, Catalog Number C3019H: Δ(ara-leu) 7697 araD139 fhuA ΔlacX74 galK16 galE15 e14-ϕ80dlacZΔM15 recA1 relA1 endA1 nupG rpsL (StrR ...
-
bioRxiv - Biophysics 2023Quote: ... Amine-modified DNA oligonucleotides (NH2/GTGATGTAGGTGGTAGAGGAA) were linked to the benzylguanine (BG; NEB), and BG-oligonuculeotides were labeled with myosin II containing a C-terminal SNAP-tag (NEB ...
-
bioRxiv - Genetics 2020Quote: ... the Trp 185 residue was changed to Arg using Q5 Quick Mutagenesis Kit (NEB #E0552) according to the manufacturer’s instructions
-
bioRxiv - Molecular Biology 2022Quote: ... and tRNA-Gly-CCC (Table S1) were radioactively labeled with gamma-32P-ATP using T4 PNK (NEB). Pre-hybridization and hybridization were performed in OligoHyb Buffer (Applied Biosystems ...
-
bioRxiv - Genetics 2022Quote: ... The codon for His4rK20 was changed to Ala using the Q5 Site-directed Mutagenesis kit (NEB E0554S). The same gRNA constructs in pCFD3 from Armstrong et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... A preadenylated universal linker (5’-rAppCTGTAGGCACCATCAAT-NH2-3’) was prepared in house or purchased from NEB (S1315S) and ligated to the 3’ ends of the dephosphorylated footprints using T4 RNA Ligase 2 ...
-
bioRxiv - Biochemistry 2022Quote: ... DED1 Trp-to-Ala point mutations were introduced using the Q5 site-directed mutagenesis kit (NEB, Frankfurt am Main, Germany) with primers carrying the sequence variation and verified by sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... Mutations to substitute N2b Lys257 and Lys261 by Ala were introduced by Q5 side-directed mutagenesis (New England Biolabs, NEB) generating pStrep2-SARS-CoV-2-N2aN2b K257A/K261A-VFETQG-Zn-M16.1 ...
-
bioRxiv - Microbiology 2023Quote: ... Mutations to substitute N2b Lys257 and Lys261 by Ala were introduced by Q5 side-directed mutagenesis (New England Biolabs, NEB) generating pStrep2-SARS-CoV-2-N2aN2b K257A/K261A-VFETQG-Zn-M16.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... with Hi-Fi DNA builder (NEB). Primers used to amplify specific regions are described in (Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2024Quote: ... and Hi-Fi DNA assembly (NEB) were used.
-
bioRxiv - Synthetic Biology 2021Quote: ... Table S2.1) for hydrogel functionalisation were synthesised by mixing one volume of 40 mM BG-PEG-NH2 (NEB S9150S) or 40 mM chloroalkane-PEG-NH2 (Promega P6741 ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Exchange of V5/His to myc/His was performed using the Q5 site-directed mutagenesis kit (NEB #E0554) according to the manufacturer’s protocol resulting in pEF1-ZAP-S-myc/His and pEF1-ZAP-L-myc/His ...
-
bioRxiv - Physiology 2020Quote: ... Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554). Adeno-associated viruses (AAV ...
-
bioRxiv - Microbiology 2024Quote: ... using NEBuilder Hi-Fi Master Mix (NEB). N-terminally hexa-histidine-tagged proteins were eluted from Ni2+-NTA resin (Thermo ...
-
bioRxiv - Cell Biology 2020Quote: ... Four hundred ng of total RNA extracted from pools of 250 mouse oocytes was ligated to 400 ng of P1 anchor primer (5’-P-GGT CAC CTT GAT CTG AAG C-NH2-3’) in a 10-µl reaction using T4 RNA ligase (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Biophysics 2022Quote: ... 2018) and a C-terminal 6x His tag and cloned into the pET21B vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Biophysics 2022Quote: ... The DNA fragment was amplified by PCR by inserting a C-terminal 6x His tag and cloned into the pETDUET-1 vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Molecular Biology 2024Quote: ... of POLQM1 were amplified off of the plasmid using primers containing a 5’ XbaI site and a 3’ KpnI site: HIS-SUMO RVS KpnI-ATTAGGTACCTCCCGTCTGCTGC HIS-SUMO FWD XbaI-TTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAG PCRs reactions used Phusion High-Fidelity DNA Polymerase (NEB) following manufacturer’s instructions and were run for 30 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 units of 2’-O-Me-transferase (New England Biolabs) and 25 units RNasin Plus RNase inhibitor (Promega) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 100 units of 2′-O-Me-transferase (New England Biolabs) and 25 units RNasin Plus RNase inhibitor (Promega) ...
-
bioRxiv - Biochemistry 2021Quote: ... 25 U Hi-T7 RNA polymerase (NEB #M0658), 250 nM RNaseAlert™ QC System v2 (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was cut with Hind III and Bam HI (NEB) for 1h at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... and His-MBP-ZFC3H1 onto an Amylose resin (NEB). After extensive washing ...
-
bioRxiv - Immunology 2021Quote: ... were assembled using Hi-Fi DNA Assembly Mix (NEB). For the SFFV-Cas9 vector ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10µg/ml) and apyrase (25mU/ml, NEB); the suspension was incubated for 1h at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Hi-Fi assembly from New England BioLabs (NEB) and other basic molecular cloning approaches ...
-
bioRxiv - Genomics 2021Quote: ... was then inserted by Hi-Fi assembly (NEB, E2621) using 0.025 pmols of vector and 0.05 pmols of the GFP amplicon ...
-
bioRxiv - Cell Biology 2021Quote: ... using NEB Hi-Fi assembly mix (New England Biolabs). A mixture of the two guide plasmids (each at 100ng/µl ...
-
bioRxiv - Developmental Biology 2023Quote: ... or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... We expressed the His-SUGCT in Lemo cells (NEB), inoculating 4L of TB with 4 mL overnight culture ...
-
bioRxiv - Genetics 2024Quote: ... by NEBuilder Hi-Fi DNA Assembly (New England Biolabs), in frame with a C-terminal 6x His-tag ...
-
bioRxiv - Plant Biology 2024Quote: ... where X is the relevant amino acid at the position of n has been substituted with the Cys) were generated by primer-based mutagenesis (New England Biolabs). The full-length precursor to cpTatC with the transit peptide from the precursor to the small subunit of RuBisCO in pGEM-4Z was used as the template (Aldridge et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and amplified via PCR with NEBNext Hi-fidelity enzyme (NEB). The resulting next-generation sequencing libraries were sequenced on a HiSeq2500 (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... Followed by subcloning the PCR amplicon in Bam-HI (NEB) restriction digested pCW57-tGFP-2A-MCS plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... using NEBuilder Hi-Fi Assembly (New England Biolabs, Cat. #E2621). The pMB1052 construct was subsequently cut using BspDI and EcoRV (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Hi-Scribe T7 High Yield RNA synthesis kit (NEB) was used to generate RNA transcripts at 37°C for 16 hours ...
-
bioRxiv - Genomics 2022Quote: ... and amplified via PCR with NEBNext Hi-fidelity enzyme (NEB).
-
bioRxiv - Cancer Biology 2023Quote: ... cut with hi-fidelity EcoRI and BamHI (New England Biolabs), and gel purified ...
-
bioRxiv - Systems Biology 2024Quote: ... using the NEBuilder Hi-Fi Assembly kit (New England Biolabs). To ensure representation of all variants in the population ...