Labshake search
Citations for New England Biolabs :
401 - 450 of 2494 citations for DnaJ Hsp40 Homolog Subfamily C Member 10 DNAJC10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... Scaffold strands (10 nM, M13mp18, Bayou Biolabs) were mixed with staple strands (100 nM ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL 10×ThermoPol Reaction Buffer (NEB), 0.5 μL 10 mM dNTP mix ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 units of RNaseH (New England Biolabs) were added to the mix and allowed to digest at 37°C for 1 h ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 µL HiFi 2X Master Mix (NEB), and water up to 20 µL ...
-
bioRxiv - Synthetic Biology 2023Quote: Restriction endonuclease BsaI (10 U/μL) (NEB), supplied with 10x NEB Buffer.
-
bioRxiv - Genomics 2023Quote: ... 10 μl Large Klenow Fragment (NEB #M0210L) was added and the chromatin is incubated for 15 min at 37°C with shaking ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM ribonucleoside-vanadyl complex (NEB, S1402S)) and incubated overnight at 37°C in a humidified chamber ...
-
bioRxiv - Molecular Biology 2023Quote: ... or with 10 µL RNaseH (NEB # M0297S) for 30 min at 37°C.
-
bioRxiv - Molecular Biology 2024Quote: ... 10 U of T4 Polynucleotide Kinase (NEB) and 40 U Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µM of dNTPs (New England Biolabs) and 10 µM of primer XhoI-T7-5’ [AGCTCTCGAGACCATGAACACCATCAATATTGCC] and EcoRI-§-T7-3’ [GCATGAATTCTCAGGCAAATGCGAAATCGGA] ...
-
bioRxiv - Biophysics 2024Quote: ... 10 units of calf intestinal phosphatase (NEB), 5 units of antarctic phosphatase (NEB) ...
-
bioRxiv - Plant Biology 2021Quote: ... and anti-MBP antibodies (NEB), respectively.
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibodies (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (NEB).
-
bioRxiv - Biophysics 2021Quote: ... in 500 μl T4 ligase buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP and 10 mM DTT, pH 7.5, NEB). Before adding the ligase ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Genomics 2023Quote: ... were mixed in 5 μL of 1x T4 DNA Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 10 mM Dithiothreitol; New England Biolabs) at a final concentration of 80 μM each and annealed by heating at 65 °C for 15 min ...
-
bioRxiv - Systems Biology 2023Quote: ... with 10 µL RT mix (5 µL 5x Maxima RT Buffer, 1.25 µL 10 mM/each dNTP [New England Biolabs #N0447S] ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bound antibodies were detected by incubation with DyLight 800-conjugated secondary antibody (New England BioLabs). An InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bound antibodies were detected by incubation with DyLight 800-conjugated secondary antibodies (New England BioLabs), and analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Cell Biology 2020Quote: ... 800ng were treated for 20’ at 37°C with 50u ShortCut Rnase III (NEB), in the digestion buffer supplied by the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 2 hours at 55°C with 0.1 mg/ml Proteinase K (NEB P8107S).
-
bioRxiv - Molecular Biology 2020Quote: ... digested overnight at 50°C with 1 μl 20 U/μl SfiI (NEB R0123S) in 200 μl 1x CutSmart buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... digested overnight at 50°C with 1 μl 20 U/μl SfiI (NEB R0123S) then rinsed with 1xTE.
-
bioRxiv - Molecular Biology 2021Quote: ... Ligation was conducted overnight at 16 °C with T4 DNA Ligase (New England Biolabs). All minigene mutations were introduced via Q5 Site-Directed Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... with BspQ1 overhangs were ligated using T7 DNA ligase (NEB M0318; 16°C overnight) into BspQ1 digested (NEB R0712 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and digested overnight at 37°C with 1 Unit of NlaIII enzyme (R0125L, NEB)/μg of DNA (under agitation-600 rpm) ...
-
bioRxiv - Plant Biology 2021Quote: ... Overnight digestion at 37 °C was performed using 400U of Hind III enzyme (NEB). Digested DNA was ligated during 5 h incubation at 16 °C with 100 U of T4 DNA ligase (NEB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 μg of Hi-C library DNA were incubated with T4 DNA polymerase (NEB) for 4 hours at 20°C to remove of biotin from non-ligated fragment ends ...
-
bioRxiv - Systems Biology 2020Quote: ... The resulting PCR products were digested for 1h at 37°C with DpnI (NEB) and transformed in competent Escherichia coli MC1061 cells ...
-
bioRxiv - Microbiology 2021Quote: ... the samples were incubated at 37°C overnight with PNGase F (New England BioLabs) to release the glycans ...
-
bioRxiv - Genomics 2021Quote: ... and 6h hours at 37°C with 20 U of MspI (New England Biolabs) in 30 μl of 1x NEBuffer 2 ...
-
bioRxiv - Microbiology 2021Quote: ... gDNA was digested overnight (37°C) with the restriction enzyme RsaI (New England Biolabs) to produce small ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... and 789-203-3C12 IgG was digested with endoproteinase Lys-C (New England Biolabs) overnight at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... and ligated at 16 °C with 10,000 U of T4 DNA ligase (NEB, M0202) in ligase buffer supplemented with 0.8% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by 30 minute incubation at 37°C with Exonuclease I (New England BioLabs) to digest single stranded
-
bioRxiv - Genomics 2022Quote: ... and incubated overnight at 37°C with MSPI (20U μl-1 NEB cat: R0106L) and 10x NEBuffer2 (NEB cat ...
-
bioRxiv - Molecular Biology 2019Quote: ... 40 µg of Hi-C library DNA were incubated with T4 DNA polymerase (NEB) for 4 hours at 20°C ...
-
bioRxiv - Microbiology 2019Quote: ... Incubation for 1 h at 55°C with 8U of proteinase K (NEB P8107S) finally disrupted viral capsids ...
-
bioRxiv - Genomics 2020Quote: ... DNA was digested for 3h at 37°C with Dpn II (New England Biolabs) and heat inactivated at 65°C for 20 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... as described below) was digested at 37 °C overnight using PstI restriction enzyme (NEB) in NEBuffer 3.1 (100 mM NaCl ...
-
bioRxiv - Microbiology 2019Quote: ... cells recovered for three hours at 37°C in SOC media (NEB, cat. # B9020S). An aliquot was then taken to titer transformants and the remaining cells (860 µl ...
-
bioRxiv - Biochemistry 2020Quote: ... The amplified backbone was treated with Dpn1 for 16 hours at 37°C (NEB) followed by a purification using a spin column ...
-
bioRxiv - Genomics 2019Quote: ... 40 μg of Hi-C library DNA were incubated with T4 DNA polymerase (NEB) for 4 hours at 20°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reaction was performed at 37° C in Smart buffer (New England Biolabs, USA) in a Real-time PCR machine (Rotor-Gene Q ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB, 1 h 50° C) into backbones previously digested with corresponding restriction enzymes (NEB ...
-
bioRxiv - Genomics 2022Quote: ... cells were digested overnight at 37°C using 50U of MboI (NEB, Cat. #R0147). After biotin filling ...
-
bioRxiv - Microbiology 2023Quote: ... gene marker cassette by overnight ligation at 4 °C with T4 DNA Ligase (NEB). Overnight ligations were transformed into chemically competent DH5ɑ E ...
-
bioRxiv - Microbiology 2023Quote: ... Ligation was performed overnight at 4 °C using T4 DNA ligase (New England Biolabs) followed by heat-inactivation for 10 min at 80 °C ...