Labshake search
Citations for New England Biolabs :
1 - 50 of 1438 citations for Dengue Virus Subtype 4 Envelope 45 kDa Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Protein molecular ladder (Color Prestained Protein Standard, Broad Range 11–245 kDa, NEB, P7712S). Dry transfer was performed using an iBlot™ 2 gel transfer device (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... The time between nuclear envelope breakdown (NEB) and anaphase onset (AO ...
-
bioRxiv - Biochemistry 2023Quote: ... per 1 µg protein for 45 min at 30°C in PMP buffer (New England Biolabs) plus 1 mM MnCl2 ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... against a Colour Prestained Protein Standard (Broad Range 10-250 kDa, New England BioLabs) and resolved by electrophoresis for 70 minutes at 150-180V ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells undergoing mitosis were tracked from nuclear envelope breakdown (NEB) to anaphase onset ...
-
bioRxiv - Biochemistry 2021Quote: ... or Endoglycosidase H (translation products of ∼50-150 kDa protein substrates; New England Biolabs, P0702S). All samples were solubilised for 12 h at 37°C and then sonicated prior to resolution by SDS-PAGE (10% or 16% PAGE ...
-
bioRxiv - Cell Biology 2020Quote: ... Mitotic duration was defined as the time from nuclear envelope breakdown (NEB) until division ...
-
bioRxiv - Biophysics 2019Quote: ... was generated as a fusion construct with N-terminal maltose binding protein (MBP) as we described previously (45) using the pMAL-c2x (New England Biolabs) variant pMALX (46) ...
-
bioRxiv - Microbiology 2021Quote: ... 9 Neuraminidase A (P0722, NEB, 4 units/µg protein). 10 µg glycoprotein ...
-
bioRxiv - Cell Biology 2019Quote: ... Entry into mitosis was taken as the time of nuclear envelope breakdown (NEB), which could be determined in our movies by adjusting the contrast to visualise when the cytoplasmic pool of the fluorescent protein was first observed to enter into the nucleus.
-
bioRxiv - Cell Biology 2022Quote: ... Entry into mitosis was taken as the time of nuclear envelope breakdown (NEB).
-
bioRxiv - Cell Biology 2019Quote: ... The time taken for each cell to progress from nuclear envelope breakdown (NEB) to anaphase onset (chromatid separation ...
-
bioRxiv - Genomics 2022Quote: ... 45 unit/mL proteinase K (NEB, P8107S) was added to the reaction and incubated for 30 min at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Immunology 2022Quote: HIV envelope plasmids were transformed and amplified in NEB-stable competent cells (NEB, C3040H). Pseudoviruses were produced by co-transfection of plasmids encoding various HIV-1 Envs together with NL4-3 ΔEnv or Q23-ΔEnv (1:3 ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Vaccinia virus Capping enzyme (NEB) and biotinylated RNA species were subsequently enriched by affinity purification using streptavidin beads yielding 0.6 to 1.3% of the sRNA preparation ...
-
bioRxiv - Genetics 2019Quote: ... a 6-cycle amplification of pre-barcoded libraries was performed using 45 μl of each library with 45 μl OneTaq 2X Master Mix with Standard Buffer (New England Biolabs), and 0.1 μM internal primers CL7244 and CL13040 with the above PCR conditions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Once PCNA foci disappear the G2 phase starts and lasts until nuclear envelope breakdown (NEB). After apical mitosis ...
-
bioRxiv - Molecular Biology 2022Quote: ... and α1-3,4 fucosidase (New England Biolabs, 4 U/μg protein). All enzymatic reactions were performed as a 1-step reaction with 1x Glycobuffer 2 (New England Biolabs) ...
-
bioRxiv - Systems Biology 2020Quote: ... Broad Range (11-245 kDa) (NEB P7712S) was loaded into an empty well.
-
bioRxiv - Synthetic Biology 2021Quote: ... Broad Range (11-250 kDa) (NEB #P7718). Native gel electrophoresis of intact VLPs was run on a 1% w/v agarose mini gel (7×7 cm ...
-
bioRxiv - Molecular Biology 2022Quote: ... The commercially available vaccinia virus capping system (NEB #M2080S) was used as a positive control.
-
bioRxiv - Microbiology 2020Quote: ... 45 s using the NEBNext Magnesium RNA Fragmentation Module (NEB) followed by RNA purification with the Zymo RNA Clean & Concentrator kit ...
-
bioRxiv - Biochemistry 2019Quote: ... 37°C with vaccinia virus capping enzyme (New England Biolabs), as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and Moloney murine leukemia virus reverse transcriptase (New England Biolabs). Using a QuantStudio 3 real-time quantitative PCR machine (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... only centriolar pairs that could be tracked from the beginning of nuclear cycle 12 until nuclear envelope breakdown (NEB) (for Sas-6)/beginning of nuclear cycle 13 (for Ana2)/throughout the entire detection window of the oscillation (for Plk4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Envelope gene mutations were introduced into WT cDNA sequence using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). All cloned were sequenced (Eurofins).
-
bioRxiv - Zoology 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (New England Biolabs, Evry, France) and random hexamer primers were used to transcribe 1 μg RNA in a 20 μl reaction into cDNA.
-
bioRxiv - Developmental Biology 2021Quote: ... All oligos were radioactively capped using Vaccinia virus capping system (NEB) and [α-32P]-GTP (Perkin-Elmer) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli strain DH10-β cells (45 μL each; C3019I, New England Biolabs) thawed on ice for 10 minutes and mixed gently by tapping ...
-
bioRxiv - Systems Biology 2020Quote: ... Broad Range (11-245 kDa) (New England Biolabs, #P7712S). Lysates were run in 1x Tris-Glycine (Thermo ...
-
bioRxiv - Molecular Biology 2022Quote: ... Broad Range (10-250 kDa) (New England Biolabs P7719S) was used as a protein standard ...
-
bioRxiv - Molecular Biology 2022Quote: ... Broad Range ladder (10-250 kDa) (New England Biolabs) were loaded on a NuPAGE 4-12 % Bis-Tris gel ...
-
bioRxiv - Biochemistry 2023Quote: ... Broad Range (10-250 kDa) (New England Biolabs #P7719S) was used as a protein standard ...
-
bioRxiv - Immunology 2020Quote: The I53-50A and I53-50B.4.PT1 proteins were expressed in Lemo21(DE3) (NEB) in LB (10 g Tryptone ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cDNA was then used as template to amplify the envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). Nested PCRs were performed ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). First round primers consisted of forward primer VIF2 (5’ – GGGTTTATTACAGAGACAGCAGAG – 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Cell Biology 2022Quote: Cytokinetic furrowing rate measurements for both the P0 cell and the AB cell were taken relative to nuclear envelope breakdown (NEB). For all analyses ...
-
bioRxiv - Molecular Biology 2021Quote: All eight gene segments of the isolated H6N1 virus were amplified (NEB), purified (Omega ...
-
bioRxiv - Microbiology 2020Quote: ... to ensure sterility before incubation for 45 minutes with 24 μl microccocal nuclease (NEB) and 15 μl DNaseI (Thermo Fisher ...
-
bioRxiv - Biochemistry 2021Quote: ... acylated dasTMPRSS2 was treated with 50 U PNGase F (NEB; 37 °C for 45 min) to trim N-glycan branches ...
-
bioRxiv - Microbiology 2022Quote: ... pZY97 (45) was digested with SacI and AatII (New England Biolabs, Cat# R0157 and R0117) simultaneously to drop out the existing resistance cassette and generate the cut vector for Gibson assembly ...
-
bioRxiv - Developmental Biology 2023Quote: ... Radioactively labeled probes were generated by annealing complementary EMSA oligonucleotides (45 µM, NEB2 buffer (NEB), heating to 95° for 2 min and cooling down to 25° with −1°C per minute) ...
-
bioRxiv - Microbiology 2021Quote: ... Virus stocks were recovered following linearization of infectious clone plasmids using NotI-HF (NEB), in vitro transcription ...
-
bioRxiv - Microbiology 2022Quote: ... The virus lysate was then denatured by boiling in denaturing buffer (New England BioLabs) for 10 min and treated with PNGase F or Endo Hf enzymes (New England BioLabs ...
-
bioRxiv - Biophysics 2023Quote: ... The mRNAs were capped using the vaccinia virus capping enzyme kit (New England Biolabs) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were expressed and purified from 2 to 4 liters of Escherichia coli NiCo21(DE3) (New England Biolabs) as previously described (24) ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were treated twice for 45 minutes at 37°C with DNase I (New England Biolabs) with heat inactivation at 75°C for 10 minutes and DNA was further removed using a RNeasy Mini kit (Qiagen) ...