Labshake search
Citations for New England Biolabs :
51 - 100 of 2483 citations for Dengue Virus Serotype 3 Envelope Protein Human Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The AAV transfer vectors used for 3-plex sgRNA delivery into skeletal muscle were cloned between AAV serotype 2 ITR’s including a cloning site for multiplexed hU6-sgRNA insertions (MluI and KpnI (NEB)) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added 150 – 1000 ng of DNA to 1 μl of prepared MBD2-Fc/protein A beads (New England Biolabs), then washed and eluted the DNA as described by Chiou and Bergey (2018) ...
-
bioRxiv - Molecular Biology 2021Quote: Myc-Tag (9B11) antibody (NEB 2276 S) and mouse IgG (Santa Cruz sc-2025 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-SNAP-tag (New England Biolabs, #P9310S) and anti-Cyclin D1 (BD Bioscience ...
-
bioRxiv - Cell Biology 2022Quote: ... or SNAP-tag (New England BioLabs, N9181S) were inserted into the retroviral plasmids pMRX-IP (harboring a puromycin-resistant marker ...
-
bioRxiv - Genetics 2020Quote: ... anti-MYC-tag (Cell Signaling Technology/NEB) at 1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... SNAP-tag DNA (pSNAPf, New England Biolabs) and β-Actin DNA (Actin mRFP-PAGFP was a gift from Guillaume Charras & Tim Mitchison ...
-
bioRxiv - Cell Biology 2023Quote: ... and SNAP-tag (New England BioLabs, N9181S) were used for tagging ...
-
bioRxiv - Microbiology 2024Quote: ... the SNAP tag (New England Biolabs #N9183S) was inserted after the Ptet or Plac promoter with the appropriate primers (supplementary methods) ...
-
bioRxiv - Molecular Biology 2020Quote: Cleavage of the MBP tag from NlGr7 was completed according to manual instructions of the pMAL protein fusion and purification system (NEB, Inc, USA). The tag (MBP ...
-
bioRxiv - Molecular Biology 2022Quote: ... The commercially available vaccinia virus capping system (NEB #M2080S) was used as a positive control.
-
bioRxiv - Cell Biology 2020Quote: ... S141A ABHD11 and H296A ABHD11 with C-terminal eGFP tags or HA tags were created using NEBuilder HiFi (NEB). ABHD11 was also cloned into a transfection vector ...
-
bioRxiv - Developmental Biology 2019Quote: ... The bound protein (~42kDa, 360 amino acids) was released from the MBP tag by cleavage with Factor Xa (New England Biolabs, Massachusetts, United States) for 24 hours at 4°C in 20mMTris pH 7.2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The synthetic genes encoding WT human TRIM28 with an N-terminal maltose binding protein (MBP) affinity tag (UniProt: Q13263) were subcloned to the pMAL-p2X vector (New England Biolabs, Beverly, MA, USA).
-
bioRxiv - Cell Biology 2022Quote: ... human emerin was first fused to the C-terminus of a SNAP tag by AscI and XhoI insertion in a pSNAP-tag(m) plasmid (NEB). SNAP-emerin was then subcloned into a modified pFUW lentiviral vector by NheI and AgeI insertion ...
-
bioRxiv - Molecular Biology 2019Quote: ... where C-terminal Myc-DDK tag was replaced by HIS-V5 tag using a NEBuilder HiFi DNA assembly kit (New England Biolabs). SHIP2 deletion in 293T cells was carried out by CRISPR/Cas9 technology (Ran et al ...
-
bioRxiv - Biochemistry 2019Quote: ... fused to a His-ZZ-TEV tag on the amino-terminus and a carboxy-terminal SNAPf tag (New England Biolabs)) and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Biochemistry 2022Quote: ... Constructs HsKHC-MDC and HsKHC-MDCL2-CaKip3 contained a cleavable C-terminal TEV-SNAP-6X-His tag (SNAP-tag from NEB). DARPin-D2 was ordered as a codon-optimized gene product from IDT and cloned into pET16b using Gibson Assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... The pDyn1 plasmid [the pACEBac1 expression vector containing insect cell codon-optimized dynein heavy chain (DYNC1H1) fused to an amino-terminal His-ZZ-TEV tag and a SNAPf tag (New England Biolabs) on the carboxy-terminus] and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Neuroscience 2022Quote: ... was cloned into pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). The exact same purification scheme for DDX5(1-535)-SNAP was used to purify DDX5(1-483)-SNAP and the protein was flash frozen in medium salt storage buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2022Quote: The full-length African killifish DDX5 was cloned into the pDEST17 vector containing an N-terminal His10-tag and a C-terminal SNAP-tag (New England BioLabs). E ...
-
bioRxiv - Neuroscience 2022Quote: The full-length African killifish DDX5 was cloned into the pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). E ...
-
bioRxiv - Neuroscience 2022Quote: ... was cloned into the pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). The same purification scheme was used to purify DDX5(1-535)-SNAP than DDX5-SNAP ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were resolved by SDS-PAGE in urea loading buffer and analysed by Western blot against the SNAP-tag (rabbit polyclonal anti-SNAP-tag antibody P9310S, New England Biolabs) to detect levels of SNAP-GLP-1R in the different fractions ...
-
bioRxiv - Cell Biology 2021Quote: The pDyn1 plasmid (the pACEBac1 expression vector containing insect cell codon-optimized dynein heavy chain (DYNC1H1) fused to a His-ZZ-TEV tag on the aminoterminus and a carboxy-terminal SNAPf tag (New England Biolabs)) and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Microbiology 2023Quote: Epitope-tagged constructs using the GST tag or the 3X FLAG tag were generated using the HiFi DNA Assembly cloning kit (NEB). MntS was cloned into pGEX-6-1 and the GST-MntS fusion was subcloned into pKT25c such that the resulting plasmid lacked the T25 region ...
-
bioRxiv - Developmental Biology 2019Quote: ... HEK293 DNA was extracted and amplified by Q5 High-Fidelity PCR (NEB, M0494S) using primers encompassing the sgRNA recognition site ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-SNAP-tag (P9310, New England BioLabs), rabbit anti-beta-tubulin (NB600-936 ...
-
bioRxiv - Cell Biology 2021Quote: ... The SNAP tag (New England Biolabs, Ipswich, MA) was amplified by PCR with compatible cut sites (HindIII and BamHI ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The SNAP tag sequence was obtained from NEB vector pSNAPtag(T7_2 ...
-
bioRxiv - Biochemistry 2019Quote: ... 37°C with vaccinia virus capping enzyme (New England Biolabs), as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and Moloney murine leukemia virus reverse transcriptase (New England Biolabs). Using a QuantStudio 3 real-time quantitative PCR machine (Life Technologies) ...
-
bioRxiv - Biochemistry 2022Quote: ... with recombinant proteins (200-500 ng) and yeast purified CK2 or recombinant human CK2 (NEB, P6010S). Proteins were resolved by SDS-PAGE and the gels were exposed to autoradiography or stained with Coomassie blue.
-
bioRxiv - Cell Biology 2019Quote: ... The bead-bound protein was incubated with 3 µM SNAP-Surface Alexa Fluor 647 (NEB) for 40-60 min at 4°C (to fluorescently label the protein) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The GST tag in this construct was replaced by a 6xHis tag using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs). N-PTEN was recombinantly expressed in E ...
-
bioRxiv - Cell Biology 2022Quote: ... only centriolar pairs that could be tracked from the beginning of nuclear cycle 12 until nuclear envelope breakdown (NEB) (for Sas-6)/beginning of nuclear cycle 13 (for Ana2)/throughout the entire detection window of the oscillation (for Plk4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Envelope gene mutations were introduced into WT cDNA sequence using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). All cloned were sequenced (Eurofins).
-
bioRxiv - Microbiology 2023Quote: ... was amplified from JE2 using the primer pair 3810/9647 and the snap-tag coding sequence amplified from pSNAP-tag (T7)-2 (New England Biolabs, NEB; Supplementary Information) using the primer pair 9631/9632 ...
-
bioRxiv - Zoology 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (New England Biolabs, Evry, France) and random hexamer primers were used to transcribe 1 μg RNA in a 20 μl reaction into cDNA.
-
bioRxiv - Developmental Biology 2021Quote: ... All oligos were radioactively capped using Vaccinia virus capping system (NEB) and [α-32P]-GTP (Perkin-Elmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... with mCherry-tag by Gibson Assembly (New England Biolabs).
-
bioRxiv - Biophysics 2022Quote: ... and 0.12 µM SiR-SNAP-Tag ligand (NEB, S9102S) for 30 min at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit polyclonal anti-SNAP-tag (New England BioLabs, P9310S), mouse monoclonal anti-HSP90 (BD Transduction Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-SNAP-tag antibody (New England Biolabs, Ref. P9310S), anti-clathrin heavy chain antibody (BD Bioscience ...
-
bioRxiv - Microbiology 2023Quote: ... was amplified from JE2 using the primer pair 3810/9647 and the snap-tag coding sequence amplified from pSNAP-tag (T7)-2 (New England Biolabs, NEB; Supplementary Information) using the primer pair 9631/9632 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cDNA was then used as template to amplify the envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). Nested PCRs were performed ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). First round primers consisted of forward primer VIF2 (5’ – GGGTTTATTACAGAGACAGCAGAG – 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Cell Biology 2022Quote: Cytokinetic furrowing rate measurements for both the P0 cell and the AB cell were taken relative to nuclear envelope breakdown (NEB). For all analyses ...