Labshake search
Citations for New England Biolabs :
51 - 100 of 2098 citations for Dengue Virus Serotype 3 Envelope Protein HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... cell and virus particle lysates were treated with PNGase F and Endo Hf (New England Biolabs) following the manufacturer’s protocol for 1 hour at 37°C prior to Western blotting.
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... RT-PCR was performed on cDNAs from murine Th17 or human HEK293 cells using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the standard thermocycling protocol ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Bioengineering 2020Quote: ... protease mutant S219V [24] was inserted at the 3’ end of gene encoding maltose binding protein (MBP) in pMAL-c5E vector (New England Biolabs, MA, USA) to construct pMAL-TEV vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... deglycosylation treatment (Dglyco) consisted of sample incubation for 3 hours at 37°C with 20 nL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per μL of sample ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Genetics 2019Quote: ... The 3′-UTR sequences of both genes were then amplified from genomic DNA obtained from HEK293 cells with Phusion® High-Fidelity DNA Polymerases (NEB, Ipswich, MA) and cloned into the multiple cloning site of the pMIR-REPORT luciferase miRNA expression vector (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... in the 5’end of 30 mer RNA substrate we used the vaccinia virus capping enzyme following the manufacturer’s protocol (New England Biolabs), except that the methyl donor SAM was absent and 0.05 units of inorganic pyrophosphatase (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2 -O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2’-O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Microbiology 2024Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2L-O-methyltransferase (New England Biolabs). The mRNA was purified ...
-
bioRxiv - Molecular Biology 2021Quote: ... The bead slurry was directly treated with 3 µL Klenow (3’→5’ exo-) (NEB) in 50 µL NEB Buffer #2 with 0.2 mM ATP at 37 °C for 30 min to add 3’ overhangs to DNA ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 µl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Biophysics 2020Quote: ... and 3-biotin-GTP (NEB) and purified using MEGAclear ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 units of DNaseI (NEB) were added and the mixture was incubated at 37°C for 1 h.
-
bioRxiv - Microbiology 2020Quote: ... 3) NEB LongAmp (NEB M0287) and 4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3□μf USER Enzyme (NEB) was then used with the size-selected ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL exonuclease buffer (NEB) and 4 μL nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL XmaI (NEB R0180S) was added to fragment chromatin ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl HinP1I (NEB R0124S), 3 μl DdeI (NEB R0175L) ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl CviAII (NEB R0640L), 3 μl FspBI (ThermoFisher ER1762) ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl DdeI (NEB R0175L), 3 μl CviAII (NEB R0640L) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL Rnl2KQ (NEB M0373S), water to 30 µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μl USER Enzyme (NEB) was then incubated with size-selected ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index Primers Set 3 (NEB). Amplified libraries were cleaned up using Sample Purification Beads (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmids encoding HA-tagged LC3B proteins were generated by replacing the EGFP sequence in the EGFP plasmids with an HA-tag followed by a Tobacco etch virus protease sequence recognition site and a Flag-Tag (Genewiz) using AgeI and HindIII (New England Biolabs). Lipidation-deficient LC3B proteins were generated by mutagenic PCR using Q5 Hot Start High-Fidelity Master Mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized from 500 ng of total RNA with retrotranscriptase from Moloney murine leukemia virus (Ref. M0253, New England BioLabs) and random hexanucleotides as primers by following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... a maltose binding protein (MBP) and a Tobacco Etch Virus (TEV) protease cleavage site in the N-terminal via Gibson assembly (New England Biolabs) as per the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2020Quote: ... mutations were inserted into the open reading frame of Vesicular stomatitis virus glycoprotein VSV-G using the Q5 SDM kit (NEB). Myc epitope-tagged SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA depleted RNA was used as the template for reverse transcription performed with Moloney murine leukemia virus (MMLV) reverse transcriptase (M0253, NEB). The cDNA samples were then diluted 1:4 in water and used in quantitative real-time PCR with genespecific primers using SsoAdvanced Universal Sybr green Supermix (1725271 ...
-
bioRxiv - Microbiology 2021Quote: ... Virus titer was determined using SYBR-based one step qRT-PCR with Luna Universal One Step qRT-PCR reagent (NEB). QuantStudio 5 (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA depleted RNA was used as the template for reverse transcription performed with Moloney murine leukemia virus (MMLV) reverse transcriptase (M0253, NEB). The cDNA samples were then diluted 1:4 in water and used in quantitative real-time PCR with gene-specific primers using SsoAdvanced Universal Sybr green Supermix (1725271 ...
-
bioRxiv - Developmental Biology 2022Quote: ... using 200-300 ng of purified RNA as template and Moloney Murine Leukemia Virus (M-MuLV) Reverse Transcriptase (M0253, NEB). cDNA was synthesised using the standard first strand synthesis protocol with random hexamers (S1230 ...
-
bioRxiv - Plant Biology 2022Quote: All ObANS genes were inserted into the pBI121 plasmid under the control of the constitutive Cauliflower mosaic virus 35S promoter using the SacI and XbaI restriction enzymes (Thermo-scientific) and the NEBuilder ligation system (NEB). The plasmids were transformed into Agrobacterium tumefaciens strain GV3101 using electrotransformation and positive colonies were selected with kanamycin ...
-
bioRxiv - Molecular Biology 2023Quote: ... A CRISPR array containing two repeats and one spacer targeting the gfp gene of recombinant Sindbis virus (SINV-GFP) was generated by annealing and extending two partially complementary DNA oligos with Q5 polymerase (NEB) (Table S1) ...
-
bioRxiv - Physiology 2023Quote: ... was obtained by reverse transcription (RT) using 1 μg of RNA and Moloney murine leukaemia virus (M-MuLV) reverse transcriptase (M0253, NEB), using the first strand cDNA synthesis standard protocol with random primers (S1330 ...
-
bioRxiv - Microbiology 2024Quote: The ectodomains of the hemagglutinin proteins from selected influenza virus strains were ordered as synthetic DNA fragments from Twist Biosciences and cloned with a barcoded fragment encoding the last 46 amino acids of WSN HA as 3-segment assembly reaction into a construct containing the 3’ non-coding region of the packaging signal and signal peptide from A/WSN/1933 influenza HA and the a Read 1 Illumina sequence and the full 5’ packaging signal from A/WSN/1933 virus using Hifi Assembly Mastermix (NEB). The backbone for this cloning reaction was a pHH21 plasmid (16 ...
-
bioRxiv - Microbiology 2024Quote: ... hepatitis delta virus (HDV) ribozyme and simian virus 40 (SV40) poly-A sequence using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) at 50 °C for 60 min ...
-
bioRxiv - Biochemistry 2023Quote: ... modified to include a tobacco etch virus (TEV) protease recognition sequence downstream of the 6xHis-tag47 using NEBuilder HiFi DNA assembly master mix (New England BioLabs). Sequences were verified by Sanger DNA sequencing [Genomics Shared Resource ...