Labshake search
Citations for New England Biolabs :
1 - 50 of 3914 citations for Dengue Virus Serotype 1 DIII envelope protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The time between nuclear envelope breakdown (NEB) and anaphase onset (AO ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells undergoing mitosis were tracked from nuclear envelope breakdown (NEB) to anaphase onset ...
-
bioRxiv - Cell Biology 2020Quote: ... Mitotic duration was defined as the time from nuclear envelope breakdown (NEB) until division ...
-
bioRxiv - Cell Biology 2019Quote: ... Entry into mitosis was taken as the time of nuclear envelope breakdown (NEB), which could be determined in our movies by adjusting the contrast to visualise when the cytoplasmic pool of the fluorescent protein was first observed to enter into the nucleus.
-
bioRxiv - Cell Biology 2022Quote: ... Entry into mitosis was taken as the time of nuclear envelope breakdown (NEB).
-
bioRxiv - Cell Biology 2019Quote: ... The time taken for each cell to progress from nuclear envelope breakdown (NEB) to anaphase onset (chromatid separation ...
-
bioRxiv - Immunology 2022Quote: HIV envelope plasmids were transformed and amplified in NEB-stable competent cells (NEB, C3040H). Pseudoviruses were produced by co-transfection of plasmids encoding various HIV-1 Envs together with NL4-3 ΔEnv or Q23-ΔEnv (1:3 ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Vaccinia virus Capping enzyme (NEB) and biotinylated RNA species were subsequently enriched by affinity purification using streptavidin beads yielding 0.6 to 1.3% of the sRNA preparation ...
-
bioRxiv - Developmental Biology 2024Quote: ... Once PCNA foci disappear the G2 phase starts and lasts until nuclear envelope breakdown (NEB). After apical mitosis ...
-
bioRxiv - Molecular Biology 2023Quote: ... The AAV transfer vectors used for 3-plex sgRNA delivery into skeletal muscle were cloned between AAV serotype 2 ITR’s including a cloning site for multiplexed hU6-sgRNA insertions (MluI and KpnI (NEB)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The commercially available vaccinia virus capping system (NEB #M2080S) was used as a positive control.
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2 -O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2’-O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Microbiology 2024Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2L-O-methyltransferase (New England Biolabs). The mRNA was purified ...
-
bioRxiv - Biochemistry 2019Quote: ... 37°C with vaccinia virus capping enzyme (New England Biolabs), as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and Moloney murine leukemia virus reverse transcriptase (New England Biolabs). Using a QuantStudio 3 real-time quantitative PCR machine (Life Technologies) ...
-
bioRxiv - Physiology 2023Quote: ... was obtained by reverse transcription (RT) using 1 μg of RNA and Moloney murine leukaemia virus (M-MuLV) reverse transcriptase (M0253, NEB), using the first strand cDNA synthesis standard protocol with random primers (S1330 ...
-
bioRxiv - Microbiology 2024Quote: The ectodomains of the hemagglutinin proteins from selected influenza virus strains were ordered as synthetic DNA fragments from Twist Biosciences and cloned with a barcoded fragment encoding the last 46 amino acids of WSN HA as 3-segment assembly reaction into a construct containing the 3’ non-coding region of the packaging signal and signal peptide from A/WSN/1933 influenza HA and the a Read 1 Illumina sequence and the full 5’ packaging signal from A/WSN/1933 virus using Hifi Assembly Mastermix (NEB). The backbone for this cloning reaction was a pHH21 plasmid (16 ...
-
bioRxiv - Cell Biology 2022Quote: ... only centriolar pairs that could be tracked from the beginning of nuclear cycle 12 until nuclear envelope breakdown (NEB) (for Sas-6)/beginning of nuclear cycle 13 (for Ana2)/throughout the entire detection window of the oscillation (for Plk4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Envelope gene mutations were introduced into WT cDNA sequence using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). All cloned were sequenced (Eurofins).
-
bioRxiv - Zoology 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (New England Biolabs, Evry, France) and random hexamer primers were used to transcribe 1 μg RNA in a 20 μl reaction into cDNA.
-
bioRxiv - Developmental Biology 2021Quote: ... All oligos were radioactively capped using Vaccinia virus capping system (NEB) and [α-32P]-GTP (Perkin-Elmer) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cDNA was then used as template to amplify the envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). Nested PCRs were performed ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). First round primers consisted of forward primer VIF2 (5’ – GGGTTTATTACAGAGACAGCAGAG – 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Cell Biology 2022Quote: Cytokinetic furrowing rate measurements for both the P0 cell and the AB cell were taken relative to nuclear envelope breakdown (NEB). For all analyses ...
-
bioRxiv - Molecular Biology 2019Quote: ... an RNA-protein complex was formed with 1 µM Cas9 protein (New England Biolabs) and 1 µM gRNA pool (3 gRNAs in total ...
-
bioRxiv - Molecular Biology 2021Quote: All eight gene segments of the isolated H6N1 virus were amplified (NEB), purified (Omega ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 units mL-1 lambda protein phosphatase (NEB), and 0.1 μg mL-1 protein phosphatase 2a (Cayman Chemical ...
-
bioRxiv - Cell Biology 2023Quote: ... and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs, 5 U μg-1 of protein) were added with gentle mixing after each addition ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μL of Lambda Protein Phosphatase (New England Biolabs) or 1 μL of phosphatase inhibitor mix (20 mM β-glycerophosphate ...
-
bioRxiv - Microbiology 2021Quote: ... Virus stocks were recovered following linearization of infectious clone plasmids using NotI-HF (NEB), in vitro transcription ...
-
bioRxiv - Microbiology 2022Quote: ... The virus lysate was then denatured by boiling in denaturing buffer (New England BioLabs) for 10 min and treated with PNGase F or Endo Hf enzymes (New England BioLabs ...
-
bioRxiv - Biophysics 2023Quote: ... The mRNAs were capped using the vaccinia virus capping enzyme kit (New England Biolabs) following the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... both proteins were deglycosylated by PNGase F (NEB, 1:50) overnight at 37°C in PBS ...
-
bioRxiv - Microbiology 2020Quote: Virus-encoding plasmids were generated using Gibson Assembly (NEB Gibson Assembly kit, NEB, Ipswich, MA). Insert amplicons containing 25 bp overlaps to target regions were generated using Kapa HiFi Hotstart™ high-fidelity polymerase (Kapa Biosystems/Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: Virus-encoding plasmids were generated using Gibson Assembly (NEB Gibson Assembly kit, NEB, Ipswich, MA). Insert amplicons containing 25 bp overlaps to target regions were generated using Kapa HiFi Hotstart™ high-fidelity polymerase (Kapa Biosystems/Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: Virus stocks were generated by either transfecting purified in vitro transcribed viral RNA (HiScribe, NEB) or transfecting the infectious cDNA clone containing plasmid in BHK-T7 cells ...
-
bioRxiv - Biochemistry 2023Quote: Infection in HCT116: Cells were infected with virus and 8 μg/mL polybrene (NEB, #H9268).
-
bioRxiv - Cell Biology 2024Quote: ... RNA was reverse transcribed with Moloney murine leukemia virus (M-MuLV) transcriptase (New England Biolabs). The purity and concentration of RNA were measured using NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... so the bead-bound proteins were dephosphorylated in wash buffer containing 1:50 Lambda Protein Phosphatase (New England Biolabs) and 1 mM MnCl2 to make the phosphosites more accessible for a kinase assay ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 µl of lambda protein phosphatase (New England BioLabs, Ipswich, MA). Each mixture was incubated at 30 °C for either 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μl of Lambda protein phosphatase (P0753L, New England BioLabs) were incubated with the proteins at 30°C for 30 minutes.
-
bioRxiv - Microbiology 2023Quote: ... cell and virus particle lysates were treated with PNGase F and Endo Hf (New England Biolabs) following the manufacturer’s protocol for 1 hour at 37°C prior to Western blotting.
-
bioRxiv - Molecular Biology 2023Quote: ... the enzymatic activity of the commerically availablale recombinant vaccinia virus methyltransferase mRNA 2’O-methyltransferase (NEB), abbreviated hereagter as VMTR1 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM MnCl2 only or together with 1 μl Lambda Protein Phosphatase (New England Biolabs). After incubation at 30°C for 30 min ...
-
bioRxiv - Genetics 2021Quote: ... 1 ul of 20 μM Cas protein (SpyCas9 and SauCas9 from NEB; Nme2Cas9 was purified as previously described (Edraki et al ...
-
bioRxiv - Microbiology 2022Quote: ... 1-20 μg of the Env protein was mixed with 1 μl of Glycoprotein Denaturing Buffer (NEB, 10×) and H2O (if necessary ...