Labshake search
Citations for New England Biolabs :
701 - 750 of 10000+ citations for DNA Sequencer since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... All DNA fragments were amplified using Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs). To construct the C1 module ...
-
bioRxiv - Microbiology 2023Quote: ... coli plasmid DNA were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, NEB) using primers as indicated in Table S1 ...
-
bioRxiv - Microbiology 2022Quote: ... then inserted into the luciferase EcoRI site by DNA ligation with T4 DNA ligase (New England Biolabs). 27 base pair constructs were generated by annealing primers together and inserting them into the luciferase EcoRI site by DNA ligation with T4 DNA ligase ...
-
bioRxiv - Neuroscience 2023Quote: ... double strand DNA template oligos were synthesized using a Phusion High-Fidelity DNA Polymerase (New England BioLabs) with the T7 specific forward primer 5’-GAAATTAATACGACTCACTATAGGN18GTTTTAGAGCTAGAAATAGC-3’ together with the common reverse primer 5’- AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTT GCTATTTCTAGCTCTAAAAC-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... was constructed by assembling 3 DNA fragments using the NEBuilder HiFi DNA assembly kit (New England Biolabs). All 3 fragments were amplified from pTRL2-His-GrgA (28 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 ng DNA was used to prepare libraries using the NEBNext Ultra II DNA kit (NEB E7645S) as described with modifications ...
-
bioRxiv - Microbiology 2023Quote: ... DNA samples were then used for library preparation using NEBNext UltraII DNA library prep kit (NEB #E7645L). Paired end sequencing of the libraries was performed using Illumina NextSeq 550 platform and atleast 3 million paired end reads were obtained for each sample ...
-
bioRxiv - Genomics 2023Quote: ... we did not measure the DNA concentrations) with a NEBNext Ultra II DNA kit (New England Biolabs) according to the manufacturer’s protocol and sequenced as 100-bp single-end reads on an Illumina NovaSeq 6000 instrument.
-
bioRxiv - Plant Biology 2023Quote: ... and DNA libraries were prepared using NEBNext® Ultra™ DNA Library Prep Kit (New England Biolabs) and size selected (∼320 bp ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from overnight cultures using the Monarch Genomic DNA Purification Kit (New England Biolabs). DNA was quantified using a Qubit 4 fluorometer (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: Complementary DNA (cDNA) encoding for Human CD36 (RC221976) was cloned using Hifi DNA assembly kit (NEB E5520S) into the pJFRC-MUH vector (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: ... extraction of genomic DNA with the Monarch® Genomic DNA Purification Kit (New England Biolabs, Ipswich, USA), Gibson assemblies with the NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... All DNA fragments were generated by PCR using Q5 Hot Start High-Fidelity DNA polymerase (NEB # M0494S). The primers for each fragment had gene-specific 3’- sequences and 15–20 additional bases at the 5’ end that overlap with the ends of the adjacent fragment ...
-
bioRxiv - Microbiology 2023Quote: ... was constructed by assembling 3 DNA fragments using the NEBuilder HiFi DNA assembly kit (New England Biolabs). All 3 fragments were amplified from pTRL2-His-GrgA 36 using Q5 DNA polymerase (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... coli plasmid DNA were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, NEB) using primers as indicated in Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted using the Monarch genomic DNA extraction and purification kit (New England Biolabs Inc.). Region of Cori and ter were quantitatively amplified using the Sybr green-based Luna Universal One-step RT-qPCR kit (New England Biolabs Inc.) ...
-
Multidrug resistance plasmids commonly reprogramme expression of metabolic genes in Escherichia colibioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted from overnight cultures using the Monarch Genomic DNA Purification Kit (New England Biolabs). DNA was quantified using a Qubit 4 fluorometer (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 μM of each forward and reverse DNA oligos were annealed in T4 DNA Ligase buffer (NEB) by heating to 95° C for 5 mins then cooling at a rate of 4°C every 2 minutes until ambient temperature was reached ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA library was prepared using the NEBnext Ultra II DNA Library Prep Kit (New England Biolabs, E7645) and NEBNext Multiplex Oligos for Illumina (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplicon was subsequently purified with column DNA Clean-up kit (Monarch PCR & DNA Cleanup Kit, # T1030L, NEB) and mixed with double-digested Nhe1/ BamH1 and gel-purified target pCW57.1 vector in a molecular ratio of 1:2 (50 ng Vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA library preparation was done using the NEBnext Ultra II DNA Library Prep Kit (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... and genomic DNA libraries were prepared using the NEBNext genomic DNA library construction kit (New England Biolabs). DNA libraries were sequenced on an Illumina Hi-Seq and deep sequencing reads were analyzed using standard methods on Galaxy ...
-
bioRxiv - Immunology 2023Quote: ... Immunoprecipiated DNA was used to prepare libraries using NEBNext Ultra II DNA library prep kit (NEB E7645S). Libraries were sequenced with paired-end 50 on an Illumina Novaseq.
-
bioRxiv - Neuroscience 2024Quote: ... 20μL of DNA were used for libraries preperation using the NEBNext Ultra II DNA kit (NEB, #E7645). Quantification of the library was performed using dsDNA HS Assay Kit and Qubit 2.0 (Molecular Probes ...
-
bioRxiv - Microbiology 2023Quote: ... and the DNA library was prepared using the NEBNext® Microbiome DNA Enrichment Kit (New England Biolabs). The sequencing run was then performed on the Element AVITI sequencer (Element Biosciences ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was isolated from the cells using Monarch® Genomic DNA Purification Kit (New England Biolabs). DNA concentration was measured with Nanodrop One/OneC spectrophotometer (Thermo Fisher) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 125V for 50 min) with SYBR Safe DNA stain (Thermo) using the 1kb Plus DNA ladder (NEB). Gel imaging was performed on a FluorChem M System (Cell Biosciences) ...
-
bioRxiv - Microbiology 2024Quote: ... DNA libraries were constructed using NEBNext® Ultra™ DNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA was isolated from ∼2×106 cells using the Monarch DNA purification Kit (New England Biolabs). For genotyping ...
-
bioRxiv - Immunology 2024Quote: ... DNA library construction was performed using the NEBNext Ultra II DNA Library Prep Kit from NEB (E7645L). The libraries were sequenced on Illumina NovaSeq 6000 system (50 bp paired-end ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA sequencing library preparation was performed using the NEBNext® DNA Library Prep Kit (New England Biolabs) following the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... Indexed DNA libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit (NEB, Cat # E7645S) with the following specifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNAs were used as templates in PCR amplification using Phusion High-fidelity DNA Polymerase (New England Biolabs). PCR products were individually treated for 16 h at 37 °C with 20 units of DpnI enzyme (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The DNA library was then ligated to the linearised pBluescript II SK (–) plasmid using T4 DNA ligase (NEB) at a 3:1 insert to vector ratio using 200 ng of the linearised vector ...
-
bioRxiv - Molecular Biology 2019Quote: ... and a DNA fragment containing GFP were inserted into pCAGEN by NEBuilder HiFi DNA Assembly Master Mix (NEB).
-
bioRxiv - Microbiology 2019Quote: ... genomic DNA libraries were prepared using NEBnext DNA Library Prep Master Mix Set for Illumina (New England Biolabs) following the instructions for 400 bp insert libraries ...
-
bioRxiv - Microbiology 2019Quote: ... The DNA fragment was inserted into plasmid pNL9164 using T4 DNA Ligase (New England BioLabs, Ipswich, MA, USA). The constructed plasmid was cloned into Escherichia coli JM109 competent cells (TAKARA ...
-
bioRxiv - Molecular Biology 2019Quote: DNA fragments from three libraries were prepared with NEBNext Ultra DNA Library Prep Kit for Illumina (NEB, USA), pooled together and sequenced on the Illumina HiSeq 2500 platform (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... Immunoprecipitated chromatic DNA was subjected to library preparation using NEBNext Ultra II DNA Library kit (NEB cat# E7645S). Briefly ...
-
bioRxiv - Synthetic Biology 2020Quote: DNA amplification was performed via PCR using the Q5 DNA polymerase and 5X Q5 buffer (New England Biolabs) in 50 µl ...
-
bioRxiv - Bioengineering 2020Quote: ... DNA assembly was mainly done by using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, US) unless specified otherwise ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB).
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB). The specificity of AlkB repair reaction was confirmed using an inactive AlkB control reaction in which Fe2+ ...
-
bioRxiv - Biophysics 2021Quote: ... Other constructs were cloned by PCR and DNA assembly (NEBuilder HiFi DNA Assembly Master Mix; New England Biolabs). The RGG domain used here is the N-terminal IDR (residues 1-168 ...
-
bioRxiv - Microbiology 2020Quote: ... DNA libraries were prepared using the NEB Next Ultra DNA Library Prep kit for Illumina (New England BioLabs). Approximately 10 Gb were sequenced with a HiSeq X Ten instrument as paired-end 150 bp reads ...
-
bioRxiv - Systems Biology 2021Quote: ... The primers were designed to support HiFi DNA assembly (NEBuilder HiFi DNA Assembly Master Mix, New England BioLabs): dxs_thermus_F (5’-AAACCATGGAGGTGCGCGATATGATCTTGGACAAGGTGAAC-3’ ...
-
bioRxiv - Plant Biology 2021Quote: ... and subsequently end repair (T4 DNA polymerase, Klenow DNA polymerase and T4 Polynucleotide Kinase; New England Biolabs, USA) and A-tailing (Klenow Fragment ...
-
bioRxiv - Microbiology 2020Quote: Amplification of adaptor-ligated DNA library was performed using barcoded primers and Phusion high-fidelity DNA polymerase (NEB) for 18 cycles according to provided instructions ...
-
DDK regulates replication initiation by controlling the multiplicity of Cdc45-GINS binding to Mcm2-7bioRxiv - Cell Biology 2020Quote: ... We next performed a ligation with 0.2 ng/uL of digested DNA and 0.04 U/uL of T4 DNA ligase (NEB) at 18°C overnight to favor intramolecular ligation ...
-
bioRxiv - Genetics 2022Quote: ... The DNA was used as a template for PCR using Q5 Hot Start DNA Polymerase (New England Biolabs), following the manufacturer’s protocol ...