Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... Using DNA polymerase Q5 (High Fidelity DNA polymerase-M0491L from NEB) we found that 5 ± 2% of the reads appeared to be different from the template sequence in this region ...
-
bioRxiv - Microbiology 2020Quote: ... Phusion DNA polymerase (NEB) was employed for this round-the-horn PCR reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Q5 DNA polymerase (NEB) was used with recommended reaction settings and reagent concentrations ...
-
bioRxiv - Microbiology 2022Quote: ... OneTaq DNA polymerase (NEB), or MilliporeSigma Novagen KOD DNA Polymerase ...
-
bioRxiv - Biochemistry 2019Quote: ... Phusion DNA polymerase (NEB) with the primer pair infunisTor and infunisTrev (Supplementary File 4 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Phusion DNA Polymerase (NEB), restriction enzymes (NEB ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Taq DNA Polymerase (NEB), Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... Phusion DNA polymerase (NEB) was used for PCR amplification ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Phusion DNA Polymerase (NEB), Q5 High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... Phusion DNA polymerase (NEB) or Q5 polymerase (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... PfuUltra DNA polymerase (NEB) and nuclease free H2O to a final volume of 50 μL ...
-
bioRxiv - Microbiology 2022Quote: ... Klenow DNA polymerase (NEB), and T4 Polynucleotide Kinase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... coli DNA Polymerase (NEB), 1 μL 10 U/μL E ...
-
bioRxiv - Microbiology 2023Quote: ... Phusion DNA-Polymerase (NEB) was used for the generation of PCR products for cloning ...
-
bioRxiv - Neuroscience 2022Quote: ... Q5 DNA polymerase (NEB) was used in PCRs to amplify proteasome subunit sequences with respective tags using PCR conditions recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... T4 DNA polymerase (NEB) treatment in the presence of 500 µM dNTPs was performed at 12°C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... T4 DNA polymerase (NEB) and Klenow DNA polymerase (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... Q5 DNA polymerase (NEB) with primer pairs covering the entire predicted coding region (primer combinations listed in Table S1).
-
bioRxiv - Microbiology 2021Quote: ... Amplification of DNA fragments was performed with either Phusion DNA polymerase or LongAmp DNA polymerase (NEB).
-
bioRxiv - Genetics 2021Quote: ... 2 µL of Taq DNA polymerase (LongAmp Taq DNA Polymerase kit, New England Biolabs), 7.5 µL of dNTPs (dNTP set ...
-
bioRxiv - Biophysics 2019Quote: ... PCR products obtained with Taq DNA polymerase were treated with T4 DNA polymerase (NEB) for 15 minutes at 12°C in 1x buffer 2.1 (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... 0.4μL Phusion DNA polymerase (NEB), 4μL 5X Phusion Buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and DNA polymerase I (NEB). DNA was purified after 2 hours incubation on thermomixer at 16°C ...
-
bioRxiv - Cell Biology 2022Quote: ... coli DNA polymerase I (NEB), RNase H (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Klenow DNA polymerase (NEB) and purified by Qiaquick PCR DNA purification kit (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... coli DNA Polymerase (NEB, #M0209L), 1 µL of dNTP (0.2mM) ...
-
bioRxiv - Microbiology 2019Quote: ... and f29 DNA Polymerase (NEB) 10 µL reaction volume at 30 °C for 24 h.
-
bioRxiv - Genomics 2021Quote: ... T4 DNA Polymerase (NEB M0203S), PolI Klenow fragment (NEB M0210S) ...
-
bioRxiv - Biochemistry 2021Quote: ... or T4 DNA Polymerase (NEB) (Figure 3C) ...
-
bioRxiv - Cell Biology 2021Quote: ... using Klenow DNA polymerase (NEB) and purified using Sephadex G-50 Nick columns (Cytiva Biosciences).
-
bioRxiv - Microbiology 2020Quote: ... Klenow DNA polymerase (NEB, M0210L), and T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: ... and DNA polymerase I (NEB) overnight at 15°C ...
-
bioRxiv - Biochemistry 2022Quote: ... 1U Taq DNA Polymerase(NEB), add water to final volum to 20µl ...
-
bioRxiv - Biochemistry 2022Quote: ... 1U Taq DNA Polymerase(NEB), 1X Standard Taq Reaction Buffer(NEB B9014S ...
-
bioRxiv - Molecular Biology 2022Quote: ... Phusion HF DNA polymerase (NEB), 200 nM of the spliced leader (SL ...
-
bioRxiv - Microbiology 2022Quote: ... Q5 DNA polymerase (NEB Biolabs) was used for PCR amplification ...
-
bioRxiv - Systems Biology 2022Quote: ... coli DNA polymerase (NEB, M0209L), E ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli DNA Polymerase I (NEB). The reaction was incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... coli DNA polymerase I (NEB) were added to each sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... and DNA polymerase I (NEB). DNA was purified after 2 hours incubation on thermomixer at 16°C ...
-
bioRxiv - Microbiology 2019Quote: ... and Taq DNA Polymerase (NEB) – 1 μl ...
-
bioRxiv - Genetics 2020Quote: ... Phusion HF DNA Polymerase (NEB) or KAPA2G Fast Genotyping Mix (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... 1U Q5 DNA Polymerase (NEB), 1x Q5 reaction buffer (NEB ...
-
bioRxiv - Immunology 2021Quote: ... 1.2μL Phusion DNA polymerase (NEB), 12μL 5X Phusion HF Buffer (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... 0.4μL Phusion DNA polymerase (NEB), 4μL 5X Phusion Buffer (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Taq DNA Polymerase (NEB). Probes were hybridized overnight in DIG Easy Hyb (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... and DNA polymerase I (NEB) were used ...
-
bioRxiv - Microbiology 2022Quote: ... Q5 DNA polymerase (NEB Biolabs) was used for PCR amplification ...
-
bioRxiv - Genomics 2022Quote: ... T4 DNA polymerase I (NEB), large fragment of DNA polymerase I (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... using Phusion DNA polymerase (NEB) and the primers (FOR 5’CTTAATTAATTAAAAGACAACAACGACCTGAATCT3’ and BACK 5’ CATGGCGCGCCCTCGAGGCCTCTTTTTACCATGTTG3’) ...