Labshake search
Citations for New England Biolabs :
1 - 50 of 1912 citations for Cytosolic arginine sensor for mTORC1 subunit 2 CASTOR2 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... synaptosomal and cytosolic factions were treated with CIP (0.5units/μg, NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Biochemistry 2024Quote: ... the membrane was incubated with HRP-conjugated secondary antibody (goat anti-rabbit HRP, BioLabs 7074P2) in 3% BSA in PBS-T shaking for 1-2 h at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... Laconic sensor mRNA was synthesised from pCS2 plasmids linearised with NotI (NEB), with mMESSAGE mMACHINE SP6 Transcription Kit (Ambion ...
-
bioRxiv - Neuroscience 2020Quote: ... a catalytic subunit of protein kinase A (PKA Cα, New England Biolabs); Ca2+/calmodulin-dependent protein kinase II (CaMKII ...
-
bioRxiv - Cancer Biology 2021Quote: ... The membrane was incubated with HRP-conjugated secondary antibodies (1:5000, NEB) for 45 mins at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... HRP-conjugated antibody binding was detected using TMB substrate (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated with anti-mouse HRP antibody (1:5000, NEB 7076S) for 1h at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... The membrane was probed with horseradish peroxidase (HRP)-conjugated anti-MBP antibody (NEB) and HRP-conjugated anti-FLAG antibody to detect MBP-TcpB and FBXO22 ...
-
bioRxiv - Cancer Biology 2021Quote: ... membranes were hybridized with primary and HRP coupled secondary antibodies (New England Biolabs, Ipswich, MA). Membranes were revealed by chemiluminescence with SuperSignal West Dura or Femto reagents and data acquired using the G-BOX-iChemi Chemiluminescence Image Capture system (Syngene ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribosomes with a spytag labeled L17 subunit was used during in vitro translation system (NEB, E3313S) to generate the stalled RNC ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the barcode and sensor regions of the biosensor libraries were amplified using Q5 PCR (New England Biolabs) directly off 5 μL of glycerol stock using primers p117 and p118 (Table 2) ...
-
bioRxiv - Biochemistry 2024Quote: Sensor constructs were amplified by a standard Q5® High-fidelity DNA-Polymerase protocol (New England Biolabs) using oligonucleotides (Table S6 ...
-
Ribosomal quality control factors inhibit repeat-associated non-AUG translation from GC-rich repeatsbioRxiv - Molecular Biology 2023Quote: ... WT hNEMF was generated by mutating the serine at site 86 to an arginine using Q5 site-directed mutagenesis (NEB, E0554S). pBI-dsRED empty vector was cloned using annealing primers flanked by NheI and EcoRV ...
-
bioRxiv - Biochemistry 2024Quote: Initial sensor construction was conducted by a two-step splicing overlap extension PCR with Phusion polymerase (New England Biolabs) using standard protocol with an adjusted elongation time of 50 s ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... To perform in vitro phosphorylation 5 μg of purified GST-NL2CT (WT or S714D) fusion protein was incubated with 2.5kUnits purified catalytic subunit of PKA (NEB) supplemented with 200 μM ATP at 30°C for the indicated time points.
-
bioRxiv - Biochemistry 2021Quote: ... cDNAs encoding each of the CBAF subunits were PCR-amplified using Phusion DNA polymerase in HiFi Phusion buffer (NEB) and subcloned into pLibMam vectors using NEBuilder HiFi (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Trx-linker concatemers (1 mg/mL) were incubated with 50,000 units of the catalytic subunit of cAMP-dependent protein kinase (PKA) (NEB)—which recognizes the RRAS motif within the central linker of the Trx-linker nonamer—in protein kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 4.1 μl of PLPPR3 ICD (final concentration 0.075 mg/ml) was mixed with 0.2 μl purified PKA catalytic subunit (final concentration 20 000 Units; #P6000S, Biolabs), 0.8 μl phosphorylation buffer (final concentration of 25 mM HEPES ...
-
bioRxiv - Neuroscience 2024Quote: ... All TARP and AMPA subunit cDNAs were subcloned into pcDNA3.1(+) by PCR amplification with high-fidelity Q5 polymerase (New England Biolabs) using primers with restriction sites in the overhangs ...
-
bioRxiv - Biochemistry 2020Quote: ... was produced by cloning five synthetic gene fragments in pE-SUMO (Life Sensors, PA) using NEBuilder HiFi DNA Assembly (New England Biolabs). For purification ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... proteolytic subunits were removed from the expression constructs using blunt end deletion following a standard Q5 mutagenesis workflow (New England Biolabs). Additionally ...
-
bioRxiv - Microbiology 2024Quote: To test the binding affinity of the TBT and TBTG mRNA to the 30S ribosomal subunit we used PURExpress ΔRibosome Kit (NEB) supplemented with 5 μM of 30S ribosomal subunit and 10 μM tRNAfMet in the presence of 1.4 μM of radioactively labelled mRNA (prepared as described above by in vitro translation followed by [32P] labelling as described for the northern blot probe labelling) ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 200 µM ATP with ot without 1 µl of recombinant PKA catalytic subunit (PKAc; New England Biolabs) in manufacturer-supplied reaction buffer at 30° C for 30min with agitation ...
-
bioRxiv - Biophysics 2023Quote: ... To enrich for fully assembled TC-TL complexes the expressome was purified via immobilizing the 50S subunit (ZS22) onto streptavidin magnetic beads (NEB). For this ...
-
bioRxiv - Biochemistry 2022Quote: ... reactions to generate catalytic arginine point mutants for AIM18 and AIM46 were performed according to the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Table S2). SDM reactions were transformed into E ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ubl-1::mCherry::pri-mir-58-sensor-mut mutation was introduced into the CMP1 ubl-1::mCherry::pri-mir-58-sensor plasmid using NEB Q5 site directed mutagenesis (New England Biolabs, E0554S) with the primers GGGATGAGATTGTTCAGTACG and TATGGTATTGGACGAAGTG ...
-
bioRxiv - Cell Biology 2021Quote: ... were subcloned into phCMV3 to express C-terminal FLAG-tagged CatSper subunits (phCMV3-CatSperd or z-Flag) using NEBuilder® HiFi DNA Assembly Kit (NEB). A stop codon was placed at the upstream of HA-encoding sequences of phCMV3 vector for FLAG-tagged CatSper subunit cloning.
-
bioRxiv - Neuroscience 2022Quote: ... The non-15N 4R tau used for small-scale chemical in vitro crosslinking was phosphorylated using cAMP-dependent Protein Kinase (PKA, catalytic subunit, New England Biolabs #P6000S) according to manufacturer guidelines (25uL reaction at 30°C for 2 hours with 200 μM ATP ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... The membranes were washed with TBS and incubated with a horseradish peroxidase (HRP)-conjugated anti-MBP monoclonal antibody (New England Biolabs; 1:5000).
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1% Tween) with 3% BSA and then incubating the strips in 1:2000 dilution of monoclonal anti-MPB-HRP antibody (NEB, Inc, USA) in a blocking buffer for 1 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and β-actin (13E5, HRP-conjugated, NEB). Membranes were washed with TBS-T and incubated with HRP-linked secondary antibodies prior to detection with Clarity-ECL chemiluminescence reagent (Bio-Rad) ...
-
bioRxiv - Genetics 2023Quote: ... and anti-rabbit HRP conjugated (NEB #7074) and anti-mouse HRP conjugated (Cell Signaling Technologies #7076 ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP conjugated (New England Biolabs, E8038S, dilution 1:10000); IRDye 680RD goat anti-mouse IgG (LI-COR ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μL GlycoBuffer 2 10X (NEB), 2 μL NP-40 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μl GlycoBuffer 2 (10X) (NEB, B3704S), 2 μl 10% NP-40 (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Neuroscience 2021Quote: ... was separated into low-protein absorption tubes (PROKEEP; Watson Bio Lab, Tokyo, Japan) and reacted with 2 μg of rabbit polyclonal anti-lactyllysine antibody (PTM Biolabs) or normal rabbit IgG (Cell Signaling Technology ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 (NEB #E7500) and 3 (NEB #E7710 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2′ O-methylated using Vaccinia VP39 (2′ O Methyltransferase) (NEB) in a reaction that also included 1X capping buffer (NEB) ...