Labshake search
Citations for New England Biolabs :
1 - 50 of 8927 citations for Cow Neuronal Acetylcholine Receptor Subunit Alpha 7 CHRNA7 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Vector DNA was dephosphorylated using quick cow intestinal phosphatase (QCIP) and ligation reactions conducted using T7 DNA ligase (NEB). Purification of DNA products was done by PCR cleanup (E.Z.N.A Cycle Pure Kit ...
-
bioRxiv - Bioengineering 2019Quote: ... coli DH5-alpha (NEB), transformation for induction test was made into E ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli (NEB 5-alpha) were used.
-
bioRxiv - Zoology 2023Quote: ... coli (NEB 5-alpha). We injected donor plasmids (20 ng/µl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli (NEB 5-alpha) for bacterial transformation ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gigas β/δ82Asn→Lys Hb mutant via site-directed mutagenesis on the Steller’s sea cow Hb expression vector by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli NEB 5-alpha (NEB) and plated onto medium with the cognate antibiotic ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli 5-alpha cells (NEB). Plasmid DNA from multiple independent clones was isolated for each construct using a Zymo Zyppy 96-well plasmid prep kit ...
-
bioRxiv - Microbiology 2023Quote: ... coli 5-alpha cells (NEB) following manufacturer’s recommendations and selected by plating on LB in the presence of appropriate antibiotics ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (NEB) and otherwise followed the manufacturers recommended protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (NEB) was used for standard cloning of other plasmids ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB5-alpha (NEB#C2987) was used for the construction of all plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... 5-HT2A receptor mutants were designed and performed using Q5 mutagenesis kit (New England Biolabs). All DNA was sequence verified using Sanger nucleotide sequencing (Retrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli (NEB 5-alpha competent cells), isolated using the Monarch Plasmid preparation kit (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... NEB 5-alpha (New England Biolabs), or XL-10 Gold (Agilent ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli NEB5-alpha (New England Biolabs) was diluted 1:100 in LB medium and grown to OD600 of 0.2 ...
-
bioRxiv - Microbiology 2022Quote: ... coli NEB® 5-alpha (NEB) according to the instructions of the manufacturer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... NEB5-alpha (NEB cat no. C2987I) competent E ...
-
bioRxiv - Neuroscience 2020Quote: ... Mutations were generated in the rat P2X2 receptor using the Q5 Site-Directed Mutagenesis Kit (NEB). Each mutation was verified by DNA sequencing and subcloned in pWPT-EF1α-P2X2-GCaMP6s-IRES-DsRed2 or pWPT-EF1α-P2X2-GCaMP6s-P2A-mScarlet lentiviral vectors.
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: To test the binding affinity of the TBT and TBTG mRNA to the 30S ribosomal subunit we used PURExpress ΔRibosome Kit (NEB) supplemented with 5 μM of 30S ribosomal subunit and 10 μM tRNAfMet in the presence of 1.4 μM of radioactively labelled mRNA (prepared as described above by in vitro translation followed by [32P] labelling as described for the northern blot probe labelling) ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli NEB5-alpha cells (New England BioLabs) for quantitative exposure assays.
-
bioRxiv - Microbiology 2022Quote: ... coli NEB® 5-alpha cells (NEB). Transformed cells were plated on LB agar containing spectinomycin (0.1 g L-1 ...
-
bioRxiv - Microbiology 2022Quote: Chemically competent NEB5-alpha cells (NEB, C2987H) were transformed with recombinant plasmids per manufacturer instructions and grown at 37°C on selective LB agar plates (BD ...
-
bioRxiv - Neuroscience 2022Quote: ... NEB 5-alpha cells (New England Biolabs) were transformed with pAAV constructs and the integrity of inverted terminal repeats and expression-related elements in selected clones were confirmed by sequencing and restriction digests ...
-
bioRxiv - Microbiology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) was used as a cloning strain ...
-
bioRxiv - Biophysics 2023Quote: ... coli 5-alpha cells (New England BioLabs). Following mutagenesis for fluorescent labeling and/or creating RTT mutations using the Q5 mutagenesis kit (New England BioLabs) ...
-
bioRxiv - Biochemistry 2023Quote: Escherichia coli (NEB 5-alpha, NEB C2987H) were grown in 5 ml LB broth at 37°C and shaking at 180 rpm until the culture reached OD600 0.7 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) was used for construction and propagation of plasmids ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) and LB Miller medium (Fisher ...
-
bioRxiv - Biochemistry 2023Quote: Escherichia coli (NEB 5-alpha, NEB C2987H) were grown in 5 ml LB broth at 37°C and shaking at 180 rpm until the culture reached OD600 0.7 ...
-
bioRxiv - Biophysics 2023Quote: ... coli cells (NEB® 5-alpha, NEB) as per the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... coli cells (NEB® 5-alpha, NEB) as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... were subcloned into phCMV3 to express C-terminal FLAG-tagged CatSper subunits (phCMV3-CatSperd or z-Flag) using NEBuilder® HiFi DNA Assembly Kit (NEB). A stop codon was placed at the upstream of HA-encoding sequences of phCMV3 vector for FLAG-tagged CatSper subunit cloning.
-
bioRxiv - Biochemistry 2019Quote: ... we used a commercial assay kit (Ph.D.-7 Phage Display Peptide Library Kit, New England Biolabs) and followed the recommended protocol for “solution phase panning with affinity bead capture” with the following modifications ...
-
bioRxiv - Neuroscience 2020Quote: ... a catalytic subunit of protein kinase A (PKA Cα, New England Biolabs); Ca2+/calmodulin-dependent protein kinase II (CaMKII ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids encoding chimeric SCS6/MLA1 and SCS6/MLA6 receptors were assembled using the NEBuilder HiFi assembly Kit (NEB) based on the domain boundaries reported in (28) ...
-
bioRxiv - Molecular Biology 2020Quote: ... NEB 5-alpha F’Iq cells (New England Biolabs) were used as the recipient strain for all plasmid constructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Escherichia coli NEB- 5-alpha (New England Biolabs) was used for cloning and BL21(DE3 ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmids were transformed into BL21-alpha cells (NEB) and plated overnight at 37 □C on kanamycin LB plates (50 μg/mL) ...
-
bioRxiv - Microbiology 2023Quote: ... coli strain NEB 5-alpha (New England Biolabs) (Table S5).
-
bioRxiv - Neuroscience 2019Quote: ... Digoxigenin (DIG)-labelled anti-sense and sense RNA probes corresponding to GPA2 and GPB5 subunits were synthesized using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, Whitby, ON, Canada). Fluorescence in situ hybridization (FISH ...
-
bioRxiv - Microbiology 2019Quote: ... and retransformed into chemically competent NEB 5-alpha (NEB) to improve yields ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli strains: NEB 5-alpha (NEB C2987, not authenticated), BL21-AI (ThermoFisher C607003 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or dam+/dcm+ strain DH5-alpha Turbo (NEB C2984) to produce unmethylated or methylated plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were transformed into NEB 5-alpha F’Iq (NEB). Standard chemically competent Escherichia coli transformation protocols were used to construct plasmid host strains ...
-
bioRxiv - Bioengineering 2023Quote: ... coli strains: NEB 5-alpha (NEB, C2987; not authenticated), BL21-AI (Thermo Fisher ...