Labshake search
Citations for New England Biolabs :
51 - 100 of 10000+ citations for Corticosterone ELISA Kit 1 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... into 96-well plate containing 2.5μl of methylase reaction buffer (1 × M.CviPI Reaction buffer (NEB), 2 U M.CviPI (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: PCR mutagenesis was performed by whole plasmid PCR with Q5 high-fidelity polymerase (New England Biolabs) followed by PCR purification (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 μM Illumina barcode (NEB-kit) to 23 μl of cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... we methylated in vitro the whole pLTR-Fluc construct using the SssI methyltransferase (New England Biolabs, M0226). The LTR fragment was then purified ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: mRNA was isolated from 6-well plates showing a cell confluency of ∼90% using the Monarch Total RNA Miniprep kit (NEB). siRNA transfection was performed 48 hours prior to RNA isolation using the Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 uL BsmbI-v2 Golden Gate Assembly Kit (NEB E1602L), and 15.03 uL nuclease free H2O ...
-
bioRxiv - Cell Biology 2021Quote: Whole cell lysates or eluted proteins after affinity purification were treated with Protein Deglycosylation Mix II (NEB, Cat# P6044), according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We engineered the Thrβ119Ser substitution by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2022Quote: For chitin-based sandwich ELISA 50 μl of chitin magnetic beads (New England Biolabs, Ipswich, MA, USA) were transferred into a 1.5 ml reaction tube ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Microbiology 2023Quote: ... Desialylation of Calu-3 cells was achieved by incubating cells grown in a 96 well plate or 24-well plate or 6 well plate with 100 U/mL α2-3,6,8,9 neuraminidase A (P0722L, NEB) in 10% FCS media for 3 h at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... The whole resulting product was then PCR-amplified using indexed primers with NEBNext High-Fidelity 2X PCR Master Mix (NEB). First ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated for 30 minutes shaking at 1.500 rpm at room temperature with protein extract (500 µg of whole cell protein extract or 150 µg of CPE) and murine RNase Inhibitor (NEB) in the corresponding protein extraction buffer (without glycerol) ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Divergent 5’ phosphorylated primers carrying the mutations were used to amplify the whole plasmid and introducer the mutations using the standard Phusion DNA polymerase protocol from NEB. Mutagenesis primers are listed in Supplementary Table 5) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... DNA fragments used in Golden Gate cloning71 were generated via partial/whole-plasmid PCR (Phusion High Fidelity DNA Polymerase, New England Biolabs) or commercially synthesized (gBlocks ...
-
bioRxiv - Biochemistry 2021Quote: ... specific to the 5′ and 3′ RNA adapter sequence (Table 3) and PCR amplified the whole cDNA using the NEB Q5 HotStart polymerase (NEB). Secondary PCR was performed to introduce TrueSeq barcodes ...
-
bioRxiv - Biophysics 2021Quote: ... The R525E-R527E mutant plasmid was generated using pET-24a-XccBphP as a template for mutagenesis using whole plasmid amplification followed by DpnI template digestion (New England Biolabs). This was achieved using Q5 High-Fidelity DNA Polymerase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... For library generation primers specific to the 5′ and 3′ RNA adapter sequence were synthesized (Table S1) and the whole cDNA was PCR amplified using the NEB Q5 HotStart polymerase (NEB). Secondary PCR was performed to introduce TrueSeq barcodes [16] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gigas β/δ82Asn→Lys Hb mutant via site-directed mutagenesis on the Steller’s sea cow Hb expression vector by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... It mainly consisted of whole genome library preparation from 100ng of gDNA following NEBNext Ultra II FS (New England Biolabs) recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... Polyadenylated RNA was then isolated from the whole-cell RNA using NEB Oligo d(T)25 Magnetic beads (NEB, S1419S) according to the manufacturers protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µL of RNA from 4 x 96 well plates was transferred to a 384 well plate with 3 µL of master mix containing 1 µL of a 10 mM stock of dNTPs (NEB Catalog# N0447L ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Molecular Biology 2022Quote: PANK3 mutations were made in a gateway compatible pDONR plasmid containing a PANK3 ORF (a gift from the lab of Ben Cravatt) by amplifying the whole plasmid with primers containing the desired mutations and using HiFi DNA Assembly Master Mix (NEB, # E2621) to re-circularize the amplicon ...
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... the whole shuttle plasmid was PCR-amplified with overlapping primers containing the desired insert and recircularised by NEBuilder (New England Biolabs, #E2621L) recombination.
-
bioRxiv - Immunology 2024Quote: ... and the pHW2000 plasmid backbone such that the whole plasmid could be assembled in a one-pot golden gate reaction with PaqCI (NEB, #R0745S). Due to repeated regions ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Neuroscience 2023Quote: ... column purified and ligated at a 1:1 vector to insert ratio using the QuickLig Kit (NEB #M2200S). The ASCL1 stop codon was subsequently mutated using the QuickChange II-XL site-directed mutagenesis kit (Agilent #200523 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µg RNA was reverse transcribed using LunaScript RT SuperMix Kit (NEB). qPCR was performed using synthesised cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... spanning the whole SARS-CoV-2 genome were amplified using the high-fidelity proofreading enzyme Q5® High-Fidelity DNA Polymerase (NEB, M0491L) in a 25 µL reaction volume using respective primers (fig ...
-
bioRxiv - Cell Biology 2022Quote: ... samples were pooled by plate and ExonucleaseI (NEB) digestion was performed ...
-
bioRxiv - Immunology 2023Quote: All PD-1 mutants were generated using Q5 site-directed mutagenesis kit (NEB) following the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was first circularized by a T4 RNA Ligase 1 Kit (M0204. NEB) and then purified by TRIzol reagent followed by isopropanol precipitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Neuroscience 2021Quote: Libraries were prepared from 1 ug RNA using a library prep kit (NEB #7770), rRNA depletion kit (NEB #E6310) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μg RNA was reverse transcribed to cDNA using LunaScript RT SuperMix Kit (NEB). qPCR was performed in 20 μl reactions containing diluted cDNA ...
-
bioRxiv - Genetics 2024Quote: ... immunoprecipitated RNA and 1% input RNA Monarch RNA Cleanup Kit (New England Biolabs, T2047L) was used according to the manufacturers’ instructions ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Microbiology 2021Quote: ... the purified cDNA was PCR amplified and barcoded using ONT’s PCR Barcoding Expansion 1-12 (EXP-PBC001) or PCR Barcoding Expansion 1-96 (EXP-PBC096) kits with LongAmp Taq 2x Mastermix (NEB, Ipswich, MA).
-
bioRxiv - Genomics 2019Quote: ... expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1) expressing ATG7 isoform 1 was derived from pCMV-myc-Atg7(2) using the Q5 site-directed mutagenesis kit (NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Developmental Biology 2022Quote: ... (2019): 1) the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, E7760) was used for library preparation ...