Labshake search
Citations for New England Biolabs :
1 - 50 of 71 citations for Cholera Toxin Subunit B since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... a catalytic subunit of protein kinase A (PKA Cα, New England Biolabs); Ca2+/calmodulin-dependent protein kinase II (CaMKII ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribosomes with a spytag labeled L17 subunit was used during in vitro translation system (NEB, E3313S) to generate the stalled RNC ...
-
bioRxiv - Biochemistry 2022Quote: The standard N-glycoprotein bovine pancreatic ribonuclease B (RNase B, New England Biolabs, USA) was used as a substrate to measure NGLY1 activity ...
-
bioRxiv - Biophysics 2021Quote: ... coli B ER2566 from NEB; ampicillin ...
-
bioRxiv - Microbiology 2024Quote: ... Single-construct plasmids expressing A-subunits were constructed via restriction digestion (NdeI and PstI, New England Biolabs) and ligation using pBAD24 (Amp+ ...
-
bioRxiv - Microbiology 2019Quote: ... 7.5 μL solution B (NEB #E6800), 2 μL E ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... To perform in vitro phosphorylation 5 μg of purified GST-NL2CT (WT or S714D) fusion protein was incubated with 2.5kUnits purified catalytic subunit of PKA (NEB) supplemented with 200 μM ATP at 30°C for the indicated time points.
-
bioRxiv - Biochemistry 2021Quote: ... cDNAs encoding each of the CBAF subunits were PCR-amplified using Phusion DNA polymerase in HiFi Phusion buffer (NEB) and subcloned into pLibMam vectors using NEBuilder HiFi (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Trx-linker concatemers (1 mg/mL) were incubated with 50,000 units of the catalytic subunit of cAMP-dependent protein kinase (PKA) (NEB)—which recognizes the RRAS motif within the central linker of the Trx-linker nonamer—in protein kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 4.1 μl of PLPPR3 ICD (final concentration 0.075 mg/ml) was mixed with 0.2 μl purified PKA catalytic subunit (final concentration 20 000 Units; #P6000S, Biolabs), 0.8 μl phosphorylation buffer (final concentration of 25 mM HEPES ...
-
bioRxiv - Genomics 2023Quote: ... 1 µl Exo-CIP Tube B (NEB) were mixed and incubated at 37°C for 4 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... for the presence of all core TFIIH subunits and appropriate fractions were pulled and mixed with 10 ml of amylose resin (New England BioLabs) pre-equilibrated in washing buffer (400 mM KCl ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... proteolytic subunits were removed from the expression constructs using blunt end deletion following a standard Q5 mutagenesis workflow (New England Biolabs). Additionally ...
-
bioRxiv - Biophysics 2023Quote: ... To enrich for fully assembled TC-TL complexes the expressome was purified via immobilizing the 50S subunit (ZS22) onto streptavidin magnetic beads (NEB). For this ...
-
bioRxiv - Microbiology 2024Quote: To test the binding affinity of the TBT and TBTG mRNA to the 30S ribosomal subunit we used PURExpress ΔRibosome Kit (NEB) supplemented with 5 μM of 30S ribosomal subunit and 10 μM tRNAfMet in the presence of 1.4 μM of radioactively labelled mRNA (prepared as described above by in vitro translation followed by [32P] labelling as described for the northern blot probe labelling) ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 200 µM ATP with ot without 1 µl of recombinant PKA catalytic subunit (PKAc; New England Biolabs) in manufacturer-supplied reaction buffer at 30° C for 30min with agitation ...
-
bioRxiv - Cancer Biology 2019Quote: ... Barcode cassette was amplified from genomic DNA with primers P5.seq-B-GLI.v1 and P7.seq-B-GLI.v1 using OneTaq® DNA Polymerase (NEB, cat ...
-
bioRxiv - Biochemistry 2021Quote: Toxins were expressed with (His)6-tags at their C-termini in competent C43 (DE3) Escherichia coli cells (NEB) for HlgA and in BL21 (DE3 ...
-
bioRxiv - Cell Biology 2021Quote: ... were subcloned into phCMV3 to express C-terminal FLAG-tagged CatSper subunits (phCMV3-CatSperd or z-Flag) using NEBuilder® HiFi DNA Assembly Kit (NEB). A stop codon was placed at the upstream of HA-encoding sequences of phCMV3 vector for FLAG-tagged CatSper subunit cloning.
-
bioRxiv - Neuroscience 2022Quote: ... The non-15N 4R tau used for small-scale chemical in vitro crosslinking was phosphorylated using cAMP-dependent Protein Kinase (PKA, catalytic subunit, New England Biolabs #P6000S) according to manufacturer guidelines (25uL reaction at 30°C for 2 hours with 200 μM ATP ...
-
bioRxiv - Biochemistry 2021Quote: ... bovine RNase B and fetuin (New England Biolabs) by PNGase F (New England Biolabs ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... coli BL21 (DE3) were transformed with the appropriate toxin construct cloned into the SapI/BamHI sites of pTwin1 (New England Biolabs). Freshly transformed colonies were used to inoculate a 10-ml starter in LB containing 0.1mg/ml Carbenicillin and 0.03mg/ml chloramphenicol ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... coli BL21 (DE3) were transformed with the appropriate toxin construct cloned into the SapI/BamHI sites of pTwin1 (New England Biolabs). Freshly transformed colonies were used to inoculate a 10-ml starter in LB containing 0.1mg/ml Carbenicillin and 0.03mg/ml chloramphenicol ...
-
bioRxiv - Microbiology 2020Quote: ... B are ligated first by T4 DNA ligase (NEB) in 40μl system ...
-
bioRxiv - Immunology 2023Quote: ... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
bioRxiv - Neuroscience 2019Quote: ... Digoxigenin (DIG)-labelled anti-sense and sense RNA probes corresponding to GPA2 and GPB5 subunits were synthesized using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, Whitby, ON, Canada). Fluorescence in situ hybridization (FISH ...
-
bioRxiv - Biochemistry 2021Quote: ... 125 to 75 U/ 5 μg RNase B (Cat.P7817S, NEB) and fetuin (Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas9 protein (IDT) was suspended with a Diluent B (NEB) to make 1 μM solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... RNase B from bovine pancreas (New England Biolabs, Ipswich MA, USA), and horse radish peroxidase (HRP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the PURExpress® kit containing Solution A and Solution B (NEB) was used to prepare the transcription-translation reaction ...
-
bioRxiv - Microbiology 2024Quote: ... coli B strain was dephosphorylated with 0.4 U/µL QuickCIP (NEB) in 1 x rCutSmart buffer (NEB ...
-
bioRxiv - Genetics 2019Quote: ... The ligation reaction mixture B consisted of appropriate amount of T3 ligase (NEB) with ligation buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... Cas9 was diluted to 7 μM with diluent buffer B (NEB, Ipswich USA) on arrival and stored at −20 °C ...
-
bioRxiv - Cancer Biology 2019Quote: Purified hTERT_191-306 proteins were incubated with CDK1-cyclin B (New England Biolabs) or purified IKK2_2-664 proteins ...
-
bioRxiv - Cell Biology 2022Quote: ... B and C oligonucleotides were phosphorylated with T4 polynucleotide kinase (NEB, Cat #M0201L) according to the manufacturer recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... The pet30-B vector was digested with Nde1 (R0111, New England BioLabs, Waltham, MA) and EcoRI-HF (R3101 New England BioLabs ...
-
bioRxiv - Genetics 2020Quote: ... 2.5 μL of Taq Buffer B (Mg-free; 10X) (New England Biolabs, Ipswich, MA, USA), 2.5 μL of dNTPs (2.5 mM of each base) ...
-
bioRxiv - Bioengineering 2023Quote: These inserts were then cloned into the pSECRETS-B cassette via USER cloning (NEB #M5505S). To maintain library diversity ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 of α2-3,6,8,9 Neuraminidase A (New England Biolabs, Fig. 2d and Extended Data Fig. 2a,b) were added with 1.5 µL of 10× GlycoBuffer 1 (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and about 200 ng of DNA was digested with the type II b enzyme BcgI (New England Biolabs). This enzyme cuts both upstream and downstream of the 6 bp recognition site ...
-
bioRxiv - Microbiology 2020Quote: ... The pSAG1:U6-Cas9:sgRNA-TgIF2K-B vector was generated using Q5 site-directed mutagenesis (New England Biolabs) (26 ...
-
bioRxiv - Microbiology 2023Quote: Five POWV-LI9 fragments were amplified from viral cDNA (Figure 1A,B) using high-fidelity Phusion polymerase (NEB) and corresponding paired primers (Table S2 ...
-
bioRxiv - Genomics 2023Quote: ... nuclei were isolated from fixed B cells and subjected to in situ digestion using 200U MboI (NEB, R0147M) for 4 hours at 37 ºC ...
-
bioRxiv - Genetics 2023Quote: ... 1.2 M sorbitol) and resuspended in digestion buffer (Buffer B, 200 mM Vanadyl ribonucleoside complex [VRC from NEB] ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2020Quote: ... DOM-A and DOM-B K945G mutants were generated by site-directed mutagenesis (New England Biolabs, Cat. No E0554S). For transfection in Drosophila cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was sheared by incubating the nuclei in 100 µl of buffer B supplemented with 1,000 units of micrococcal nuclease (M0247S; NEB) for 30 min at 37°C ...