Labshake search
Citations for New England Biolabs :
1 - 50 of 346 citations for CD25 Mouse Monoclonal Alexa488 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-MBP (NEB, E8032). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and ThermoFisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal anti-MBP (1:2000, NEB), rabbit polyclonal anti-Spo11 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... or SNAP-surface-Alexa488 (NEB) were added at the secondary antibody staining stage ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse monoclonal anti Pan-Keratin (clone C11, NEB, 4545S). Primary antibodies were incubated with sections overnight at 4°C except for anti-CD3 ...
-
bioRxiv - Biochemistry 2023Quote: ... mouse monoclonal antibodies against PAR (clone 10H, Tulip BioLabs, USA), anti-mouse antibodies conjugated with horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Maltose Binding Protein monoclonal antibody IgG2a (New England Biolabs), mouse anti-Histone H3 [Trimethyl Lys9] 6F12-H4 (Novus Biologicals) ...
-
bioRxiv - Biochemistry 2023Quote: ... protein was combined with 1.5x molar excess of SNAP-Surface Alexa488 dye (NEB, Cat# S9129S). SNAP dye labeling was performed in buffer containing 20 mM Tris [pH 8.0] ...
-
bioRxiv - Biochemistry 2023Quote: ... Btk-SNAP was combined with a 1.5x molar excess of SNAP-Surface Alexa488 dye (NEB, Cat# S9129S) and incubated overnight at 4ºC ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Microbiology 2021Quote: ... or radio-labeled Msp1-digested pBR322 (NEB). Membranes were hybridized with complementary RNA probes ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-MBP murin monoclonal antibody (Biolabs) was immobilized (around 11000 responsive units (RU) ...
-
bioRxiv - Biophysics 2022Quote: Open complexes were pre-formed by incubating an excess of RNAP holoenzyme (>1.7 nM active) with <400 pM γ-32P-labeled promoter DNA (labeled with T4 polynucleotide kinase from NEB) in BB at 37 °C for at least 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... radioactively labeled using Klenow fragment (New England Biolabs) and [α-32P]dCTP ...
-
bioRxiv - Microbiology 2022Quote: ... and end- labeled using T4 polynucleotide kinase (NEB) with [γ-32P] ATP (Perkin Elmer) ...
-
bioRxiv - Genomics 2019Quote: ... labeled DNA was repaired with Taq ligase (NEB) at 37 °C for 30 min to restore integrated double strands DNA ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... Probe was labeled with T4 PNK (NEB M0201S) at 37°C for 1 h in a reaction containing 20 pmol probe ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide was 5’-labeled using PNK enzyme (NEB). The ITS2 probe was previously reported (Donati et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA Probes were labeled with DIG (New England Biolabs) or DNP-11-UTP (Perkin Elmer ...
-
bioRxiv - Genomics 2020Quote: ... Biotin labeled dATP (Thermo,19524016) and Klenow (NEB, M0210) were used to fill restriction fragment overhangs ...
-
DDK regulates replication initiation by controlling the multiplicity of Cdc45-GINS binding to Mcm2-7bioRxiv - Cell Biology 2020Quote: ... the FLAG eluate was labeled with SNAP-Surface549 (NEB) by incubating 3x molar excess of dye at 4°C overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5’ end-labeled using T4 polynucleotide kinase (NEB) and [γ-32P] ATP ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1M cells were labeled with SNAP-Surface 647 (NEB) following manufacturer’s recommendation (50 μM concentration of SNAP-Surface 647 in complete cell media ...
-
bioRxiv - Developmental Biology 2023Quote: ... and end-labeled using T4 polynucleotide kinase (M0201, NEB) and [γ-32P] ATP (NEG002A250UC ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Genomics 2019Quote: ... and labeled using the enzyme Nt.BspQI (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genomics 2019Quote: ... and labeled using the enzyme Nt.BspQI (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Immunology 2019Quote: ... cells were labeled with CLIP-Surface 547 (NEB, catalog S9233S) and SNAP-Surface Alexa Fluor 647 (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... Telomere probe was labeled using T4 polynucleotide kinase (NEB M0201) and <ι>γ-P32-ATP (Perkin Elmer NEG035C ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were pulse-labeled with SNAPcell-505 (1 µM; NEB) for 20 min in media ...
-
bioRxiv - Biochemistry 2022Quote: ... and labeled with [γ-32P]ATP by T4 PNK (NEB), followed by gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... and 7SK (GTGTCTGGAGTCTTGGAAGC) were radioactively labeled using T4 PNK (NEB) and ∼10x106 cpm of each probe were added to the membrane ...
-
bioRxiv - Molecular Biology 2022Quote: Anti-M13-pIII monoclonal antibody (E8033S, New England Biolabs), sheep anti-mouse IgG (H/L):HRP (AAC10P ...
-
bioRxiv - Cancer Biology 2021Quote: ... Northern probes were labeled with 32P ATP with T4 PNK (NEB), purified with a G25 column (GE Healthcare) ...
-
bioRxiv - Cell Biology 2021Quote: ... and labeled with SNAP-Cell TMR-Star (New England Biolabs, S9105S) or SNAP-Cell 647-SiR (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was labeled with gamma-32P-ATP using T4 PNK (NEB). After washing with PNK buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The probes were labeled using T4 polynucleotide kinase (New England BioLabs) and [γ-32P] ATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The labeled oligonucleotide (∼5 pmol) was treated with uracil glycosylase (NEB) in 1x UDG buffer (20 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: ... the substrates used are 5’-end-labeled with T4 PNK (NEB) in the presence of gamma 32P-ATP ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were labeled with Oregon-Green SNAP substrate (New England Biolabs) at 4 µM final concentration for labeling of the newly synthesized CENP-A molecules ...
-
bioRxiv - Molecular Biology 2019Quote: Atto647N-labeled target DNA was generated with Q5 DNA polymerase (NEB) using oligonucleotides 365 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Northern probes were labeled with 32P ATP with T4 PNK (NEB) and purified with a G25 column (GE healthcare) ...
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl anti-MBP Monoclonal Antibody (New England Biolabs, #E8032L) and 6 μl anti-E ...
-
bioRxiv - Cell Biology 2019Quote: ... Shi-SNAP was labeled fluorescently with SNAP-Surface 488 (New England Biolabs), and Shi-SNAP-Surface 488-mediated actin bundles were visualized by TIRF imaging ...
-
bioRxiv - Cell Biology 2020Quote: ... and then labeled with SNAP-surface-549 (New England Biolabs, Ipswich, MA) overnight at 4°C following the manufacturers’ protocols ...
-
bioRxiv - Microbiology 2021Quote: ... Dephosphorylated RNA was then 5’ end-labeled with 20U T4 PNK (NEB) and 30μCi [g32-P]ATP (Perkin-Elmer) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were labeled with 500nM SNAP-Surface 649 (New England Biolabs, #S9159S) for 5 minutes at 37°C for TIR-FM imaging or 1μM permeable SNAP-Cell 647-SiR (New England Biolabs ...
-
bioRxiv - Immunology 2020Quote: ... The enriched Br-dU labeled RNAs were incubated with RppH (NEB, #M0356S) and with T4 PNK (NEB ...
-
bioRxiv - Bioengineering 2020Quote: ... Probes were labeled with ATP-P32 using T4 polynucleotide kinase (NEB®) and blot was exposed to a phosphor screen (GE® ...