Labshake search
Citations for New England Biolabs :
51 - 100 of 2925 citations for Bcl 2 Binding Component 3 BBC3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 2013) with probes synthesized using components based on the NEBlot Phototope Kit (New England BioLabs, Cat# N7550) and detected using components based on the Phototope-Star detection kit (New England BioLabs ...
-
bioRxiv - Genomics 2019Quote: ... and deaminated with 100 U of APOBEC3A (EM-seq components E7133AA and E7134AA NEB, Ipswich, MA, USA) in 100 µl reaction volume for 3 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification of the library was performed with components of the NEBNext Ultra II DNA kit (NEB E7645S) and a NEBNext Multiplex Oligos set (e.g. ...
-
bioRxiv - Cell Biology 2019Quote: ... The pTATi1-TetO7Sag4 vector backbone was constructed from a four-component HiFi assembly (Cat# E5520, New England Biolabs): 1 ...
-
bioRxiv - Immunology 2020Quote: ... Linker insertion and modifications in the antigen-bearing components were achieved using Q5 Site Directed Mutagenesis Kit (NEB). Custom DNA primers produced by Integrated DNA technologies (IDT) ...
-
bioRxiv - Biochemistry 2021Quote: Each cyclization reaction contained the following components: 1 µL 10X T4 DNA ligase reaction buffer (New England BioLabs), 2 µL water ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Genomics 2020Quote: ... Nascent RNA was purified by binding streptavidin beads (NEB, S1421S) before and in between the following procedures ...
-
bioRxiv - Biophysics 2020Quote: ... for the substrate-binding domain mutants and βamHI-AlwnI (NEB) for the transmembrane domain mutants (Appendix) ...
-
bioRxiv - Genomics 2022Quote: ... Nascent RNA was purified by binding streptavidin beads (NEB S1421S) and washed as described by Mahat et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Second end processing and library amplification were performed with components of the NEBNext Ultra II DNA kit (NEB E7645S) and a NEBNext Multiplex Oligos set (e.g ...
-
bioRxiv - Synthetic Biology 2021Quote: ... carrying all remaining components in a Golden Gate reaction performed as described above but with Esp3I (10,000 U/mL, NEB) instead of BsaI ...
-
bioRxiv - Molecular Biology 2019Quote: ... The samples were then transferred on to the ice and the components (15 μl Blunt ligase master mix, 2.5 μl NEB Next adaptor for Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 pmol of TP_MAAAPQKCAAA* mRNA (see “Toeprinting assays” section) and components of the PURExpress ΔRibosomes Kit (New England Biolabs). The reaction was incubated at 37ºC for 20 min and then diluted in 50 mM Hepes KOH pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Genomics 2019Quote: ... was ligated to the 3’-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242L) in presence of PEG 8000 (2.5% w/v) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2021Quote: ... 100μg/ml single stranded DNA binding protein (gp32) from T4 (NEB), 277μg/ml T4 DNA clamp ...
-
bioRxiv - Neuroscience 2021Quote: ... were ligated to end-repaired and A-tailed chromatin using components from NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) (25).
-
bioRxiv - Microbiology 2021Quote: ... The URA3 and 2μ components were amplified from pYES2 using primers (actatagcagcggaggggttggatcaaagtcttcctttttcaatgggtaataactga and caaccacagggttcccctcgggatcaaagtacaatcttcctgtttttggggc) using Phusion DNA polymerase (New England Biolabs) with annealing at 63°C and a 2 minute extension ...
-
bioRxiv - Genetics 2022Quote: ... We then combined SwaI digested BFA0190 and the components of each TFT reporter and used the NEB HiFi Assembly Kit (NEB) to produce each TFT plasmid ...
-
bioRxiv - Molecular Biology 2020Quote: ... put on ice for 5 min and the following components were added in the specified order: 1x capping buffer (NEB), 0.5 mM GTP ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were carried out in 10 μl of the purified components from the PURExpress In Vitro Protein Synthesis Kit (E6800S/L, NEB) with the corresponding templates ...
-
bioRxiv - Synthetic Biology 2021Quote: An aqueous mixture comprising all of the components for a RCA reaction was prepared to include: 1X Phi29 buffer (New England Biolabs), which has 50 mM Tris-HCl at pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... such that the final concentration of components in the 20 μl PCR were: 1X Q5 Reaction Buffer (New England Biolabs), 1X Q5 High GC Enhancer (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Microbiology 2022Quote: ... 23 nt RNA (5’-GAAUCUAUACAUAAAGACCAGGC-3’) was capped with vaccinia capping enzyme and 2’-O-methyltransferase (NEB) and radiolabelled with [α 32P]-GTP ...
-
bioRxiv - Microbiology 2019Quote: 2–3 μL of recovered DNA was electroporated into NEB® 10-beta Electrocompetent cells (C320K, NEB) and plated on chloramphenicol LB plates ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Molecular Biology 2022Quote: 3’ linker ligation (1x PNK buffer, 800 U T4 RNA ligase 2 truncated KQ (NEB, Cat#M0373L), 80 U RNaseOUT ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’adapter was ligated to the dephosphorylated RNA using T4 RNA ligase 2 KQ (NEB, M0373L) at 25°C for 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
bioRxiv - Molecular Biology 2023Quote: RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB; #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... were ligated to 3′ barcoded DNA adapters using truncated T4 RNA ligase 2 (New England Biolabs, #M0373). These fragments were separated in an 12% denaturing polyacrylamide-urea gel ...
-
bioRxiv - Genomics 2024Quote: ... along with a 4.8uL 3:2 master mix of T4 ligase buffer:T4 ligase (New England Biosciences, NEB) and 9.4uL of nuclei buffer with BSA (NBB ...
-
bioRxiv - Bioengineering 2022Quote: ... Genes encoding individual components of biosensors were amplified by polymerase chain reaction (PCR) using Q5® High-Fidelity DNA Polymerase (New England Biolabs). Site-directed mutagenesis was performed by QuikChange lightning mutagenesis kit (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... ptubg-[DCX orthologue]-mNeonGreenFP was generated with a three-component assembly using the NEBuilder HiFi Assembly kit (New England Biolabs, E2621S) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Vector components were purified using the Monarch® DNA Gel Extraction Kit or the Monarch® PCR & DNA Cleanup Kit (NEB) and assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... reaction was performed to remove sfGFP and replace it with the cassette components (P1-FLAG, P2-Substrate, P3-HA, P4-ERS). This plasmid was transformed into competent Escherichia coli (E. coli) (NEB#C2984H), purified (QIAGEN #27106 ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 2-3 μg of source DNA plasmid (<10 kb) was added with NEBuffer 3.1 (NEB, cat# B7203S), DEPC ddH2O in a volume of 30 μl and incubated at 37 °C for >2 hour (h) ...