Labshake search
Citations for New England Biolabs :
51 - 100 of 3162 citations for Astrovirus Antigen Type 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... gDNA was digested with the CspCI Type IIB restriction enzyme (IIB-REase - New England BioLabs, Inc.) which has shown to yield a high marker density in triatomine65 ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by digestion of the wild-type strand with the enzyme BsurI (New England Biolabs, R0581S)[27] ...
-
bioRxiv - Microbiology 2020Quote: ... The wild-type Chlamydia trachomatis ct276 gene was amplified by PCR with Phusion DNA polymerase (NEB) using 100 ng C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Golden gate (Type-IIS) cloning was conducted using chemically competent Escherichia coli DH5α cells (NEB, C2987H). Construction of destination vectors with the toxic selection marker ccdB was done with chemically competent One Shot ccdB Survival 2 T1R E ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mutations were introduced into UNC-45B wild-type using the Q5® Site-Directed Mutagenesis Kit (NEB). Recombinant protein expression was induced in BL21 DE3 when optical density (OD600 ...
-
bioRxiv - Microbiology 2019Quote: ... Genes of interest were amplified from Synechocystis 6803 wild type genomic DNA with the Phusion Polymerase (NEB) according to manufacturer’s guidelines ...
-
bioRxiv - Plant Biology 2019Quote: ... the sgRNA vectors were digested with the type IIS restriction enzyme BsaI (New England Biolabs, cat#R0535S) and dephosphorylated with Calf Intestinal Alkaline Phosphatase (Takara ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting plasmid pFN_7_37_2k_kanRn was generated by the type IIS restriction enzyme BbsI and T4 DNA ligase (both NEB, USA). Another version of kanR with slightly different 5’ and 3’UTR was generated by PCR using the primer pair F13 ...
-
bioRxiv - Cell Biology 2022Quote: ... the wild-type and OGG1 (G245A) coding sequences were amplified by PCR with Phusion DNA polymerase (NEB) (primers indicated in Table S2 ...
-
bioRxiv - Immunology 2023Quote: ... we pooled all the eBlocks at equal molar ratio and used PaqCI Type IIs restriction enzyme (NEB), NEBridge Ligase Master Mix (NEB) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The variants were created from the wild type plasmids using the Q5 Site-Directed Mutagenesis Kit (NEB) and transformed into MegaX cells made chemically competent (Mix & Go E ...
-
bioRxiv - Developmental Biology 2023Quote: ... and ligated into the BioID plasmid using type II restriction enzymes BamHI and XhoI (New England BioLabs) and T4 DNA ligase ...
-
bioRxiv - Biochemistry 2024Quote: The cloning of human wild type Mad2 and the mutant Mad2R133A by the USER® method (NEB) into the pRSFDuet-1 vector (71341-3 ...
-
bioRxiv - Cell Biology 2024Quote: ... wild-type or mutant VPS35L sequences were amplified using Q5 High-Fidelity 2X Master Mix (NEB, M0492) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and about 200 ng of DNA was digested with the type II b enzyme BcgI (New England Biolabs). This enzyme cuts both upstream and downstream of the 6 bp recognition site ...
-
bioRxiv - Microbiology 2019Quote: ... 10 ng of DNA derived from colonies of BW25113 and BW25113ΔxerC infected with either EC6098 wild type or EC6098ΔdifC were cut with restriction enzyme HindIII (NEB) for 1h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA of wild-type and stat3 mutants were generated by the ProtoScript First Strand cDNA Synthesis Kit (NEB) using random primers ...
-
bioRxiv - Neuroscience 2023Quote: Specificity of anti-H3K9Me3 was tested against two types of substrates: recombinant histone H3 (New England BioLabs, M2507S), which lacked methylation ...
-
bioRxiv - Systems Biology 2023Quote: ... the wild-type protein extracts were incubated with 40 units of Lambda Protein Phosphatase (New England Biolabs, P0753S) at 30°C for 30min ...
-
bioRxiv - Bioengineering 2023Quote: ... cloning was achieved via one-pot restriction-ligation reactions with type IIS restriction enzymes (NEB or Thermo Scientific) and T4 DNA ligase (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... pREP81-FLAG plasmid carrying wild-type srs2+ was constructed using the Gibson Assembly® Cloning Kit (NEB E5510S). After Gibson cloning ...
-
bioRxiv - Microbiology 2024Quote: ... using a golden gate assembly strategy (19) and a type-II restriction SapI enzyme (New England Biolabs, R0569). A similar cloning strategy was used to build vectors bearing a JcDV viral genomes with fragments of cellular genes (~160 nucleotides ...
-
bioRxiv - Developmental Biology 2024Quote: ... the rbm8a wild type allele was genotyped by restriction digest of the PCR product with Xmn1 (R0194S, NEB) and the rbm8aΔ3 allele by Hinf1 (R0155S ...
-
bioRxiv - Neuroscience 2023Quote: ... This was confirmed in N1 heterozygous AtrxR245C/+ females after digestion of the wild-type allele using FspI (NEB R0135S) and gel purification of the uncut mutant band ...
-
bioRxiv - Immunology 2023Quote: ... We pooled the second set of eBlocks at equal molar ratio and used Esp3I Type IIs restriction enzyme (NEB), NEBridge Ligase Master Mix ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and terminator) was assembled in one-pot Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs, NEB). Transcription units to assay the sensor output contained the PQS promoter expressing the gfp gene ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and terminator) was assembled in one-pot Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs, NEB). Transcription units to assay the sensor output contained the PQS promoter expressing the gfp gene ...
-
bioRxiv - Cancer Biology 2024Quote: ... Specific mutations in human PSEN1 were obtained by Q5 site-directed mutagenesis of the pMSCV-puro vector containing wild type human PSEN1.26 We designed primers for Q5 site-directed mutagenesis (New England Biolabs) with NEBaseChanger.neb.com and performed site-directed mutagenesis according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... single point mutations were introduced to the respective wild-type plasmids by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (NEB). The used primers are listed in table 1.
-
bioRxiv - Microbiology 2019Quote: ... were amplified from genomic Synechocystis 6803 wild type DNA using specific primers (Table S1) and Phusion Polymerase (New England Biolabs). After restriction digest with BamHI and NotI ...
-
Calibrated feedback illumination for precise conventional fluorescence and PALM imaging applicationsbioRxiv - Biophysics 2019Quote: ... Wild-type ADE2 was amplified from genomic DNA, RB201 (W303 MATa, trp1, leu2, ura3, his3, can1R, ADE2) with Phusion PCR (NEB) using the forward primer (ATGGATTCTAGAACAGTTGGTATATTGGGAGGGGGACAA ...
-
bioRxiv - Genomics 2020Quote: We used the prepared DNA of each clone and the wild type gene for amplification by PCR with Q5 polymerase (NEB) using primers which included the minION barcodes adapters ...
-
bioRxiv - Biophysics 2021Quote: Wild-type MukB was 6×His-tagged at the C-terminus and was expressed from plasmid Pet21 in C3013I cells (NEB). For Immobilized His6-tagged MukB ...
-
bioRxiv - Biochemistry 2020Quote: ... Human wild-type TDP-43 was amplified in two separate PCR reactions excluding the NLS and reassembled using Gibson cloning (NEB) into a Doxycycline-inducible expression vector containing an N-terminal mClover3 tag ...
-
bioRxiv - Neuroscience 2019Quote: ... The R1320P mutation was created in a wild-type cDNA using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Wild-type and R1320P mutant dNf1 were then subcloned into the pUAST-attB vector with an in-frame C-terminal fusion with eGFP cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... CASP1 and CASP4 CDS were amplified from the obtained library and cloned into the pMSCV-puro vectors The caspase-4 catalytically dead C258A pMSCV-puro vector was generated from the wild-type pMSCV-puro-CASP4 through site-directed mutagenesis by PCR using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The CASP4 and GSDMD-targeting lentiviral vectors (pGIPZ ...
-
bioRxiv - Cell Biology 2020Quote: ... The open reading frame for a KIF18A wild-type siRNA resistant construct51 and pEM791 vector49 were amplified with primers designed for Gibson Assembly (New England BioLabs). After confirming the correct sequence of the Gibson assembled plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ and 3’ flanking sequences containing recognition sites for the Type II restriction enzyme BsaI-HF®v2 (NEB, R3733) were added to each IUPAC DNA block ...
-
bioRxiv - Biophysics 2021Quote: ... The 5’-terminus was capped with a type I 7-methylguanosine cap (m7G) using the Vaccinia Capping System (NEB, M2080S) and 2’-O-methyltransferase (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... Most point mutants and wild-type variants were generated from this vector following the Q5 Site-Directed Mutagenesis Kit protocol (E0554, New England Biolabs) and primers 1-8 (Sup ...
-
bioRxiv - Bioengineering 2020Quote: In-vitro digestion reactions were carried out with three different types of the Cas12a family (LbCas12a, AsCas12a, and FnCas12a were purchased from New England Biolabs Inc. ...
-
bioRxiv - Biochemistry 2021Quote: ... The insert is fused during cloning through an overlapping proline-encoding CCG codon introduced by reverse and forward primers at the 3’- and 5’-end of the sybodies and MBP respectively and released by digestion with the Type IIS restriction enzyme SapI (NEB). The second proline of the linker is encoded in the forward primer of the MBP (3’ of the overlapping CCG codon ...
-
bioRxiv - Cell Biology 2021Quote: To generate inducible vectors for MST2 wild type and del EDG we amplified the Flag2x _Strep2x fused to the MST2 constructs (wild type and del_EDG) with Q5 High-Fidelity Polymerase (New England BioLabs, # M0492) using specific primers (EcoRI_Flag_Fw and MST2_AgeI_Rv ...
-
bioRxiv - Microbiology 2021Quote: ... reverse: 5’-GATGGCGTGGAACCATGTC-3’) were obtained from the wild type plasmids pCMV-hnCoV-S via Q5 SiteDirected Mutagenesis Kit (NEB). pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward ...
-
bioRxiv - Molecular Biology 2020Quote: ... Wild-type (wt) gRNA was in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... HDR plasmid with mutant me31B genes was generated by mutating the me31B wild type gene in the wildtype HDR donor plasmid by using the Site-Directed Mutagenesis kit (New England Biolabs) according to the manufacturer’s recommended protocols ...
-
bioRxiv - Biophysics 2022Quote: ... the assembled sequences were transferred to the target plasmids (WT, MUT) by using a different set of type IIS enzymes (BbvI, New England Biolabs #R0173 ...
-
bioRxiv - Microbiology 2022Quote: The full-length badR gene was amplified from the genome DNA of the wild-type Borrelia using High-Fidelity Taq Polymerase Fusion (NEB). The fragment was subsequently ligated into the pMAL-c2X (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... The relative abundance of oligomannose-type glycans was measured by digestion with Endoglycosidase H (per sample in 20 µl volume) (Endo H; New England Biolabs). A 6 µl aliquot of labelled glycans was combined with 1 µg endoH to a final volume of 20 µl ...