Labshake search
Citations for New England Biolabs :
351 - 400 of 10000+ citations for Arg8 Vasopressin AVP Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... coli NEB® 5-alpha cells (NEB). Transformed cells were plated on LB agar containing spectinomycin (0.1 g L-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... NEB 5-alpha cells (New England Biolabs) were transformed with pAAV constructs and the integrity of inverted terminal repeats and expression-related elements in selected clones were confirmed by sequencing and restriction digests ...
-
bioRxiv - Microbiology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) was used as a cloning strain ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl T4 DNA ligase (both NEB) and 5 µl FastDigest Eco31I (BsaI isoschizomer from ThermoFisher) ...
-
bioRxiv - Biochemistry 2023Quote: Escherichia coli (NEB 5-alpha, NEB C2987H) were grown in 5 ml LB broth at 37°C and shaking at 180 rpm until the culture reached OD600 0.7 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) and LB Miller medium (Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 5 U AMV-RT (NEB, M0277S) and gene-specific reverse primers ...
-
bioRxiv - Biochemistry 2023Quote: Escherichia coli (NEB 5-alpha, NEB C2987H) were grown in 5 ml LB broth at 37°C and shaking at 180 rpm until the culture reached OD600 0.7 ...
-
bioRxiv - Biophysics 2023Quote: ... 5 units of restriction enzyme EcoRI (NEB) were added to the nucleosome array in the absence and presence of DBDC/EBP⍺ ...
-
bioRxiv - Genetics 2023Quote: ... followed by 5′ phosphorylation (New England BioLabs), repurification ...
-
bioRxiv - Genomics 2023Quote: ... and/or BglII (5 U, NEB, R0144L) in 1X CutSmart buffer (for MseI/NdeI digestions ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL dNTPs (New England Biolabs #N0447L), 2.5 μL SUPERase In ...
-
bioRxiv - Biophysics 2023Quote: ... coli cells (NEB® 5-alpha, NEB) as per the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... coli cells (NEB® 5-alpha, NEB) as per the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... coli 5-alpha cells (New England BioLabs). Following mutagenesis for fluorescent labeling and/or creating RTT mutations using the Q5 mutagenesis kit (New England BioLabs) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) was used for construction and propagation of plasmids ...
-
bioRxiv - Genomics 2024Quote: ... and 5 units of EPAP (NEB, M0276L). The reaction was incubated at 37°C for 5 min ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart buffer 10x (NEB), 5 μl of ATP 10 mM ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart buffer 10x (NEB), 5 μl of ATP 10 mM, ...
-
bioRxiv - Genomics 2024Quote: ... and 5′ hydroxyl repair with PNK (NEB). The 5′ adapter was ligated with T4 RNA ligase (NEB) ...
-
bioRxiv - Genetics 2021Quote: ... 2nd cDNA strand was again synthesized using a transcript specific primer (either 5’UTR_βG-intron _F or 5’UTR_CMV _F2, Table 4) and Q5 2x master mix (NEB, #M0494). After another round of bead purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli Poly(A) polymerase and 5’-ends were converted to mono-phosphates by incubation with RNA 5’ Pyrophosphohydrolase (NEB). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The ITS PCR reactions were performed in 25 μl with the following composition: 5 μL 5× buffer containing MgCl2 at 1.5 mM (New England Biolabs), 0.1 mM each dNTP ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 μl 5x PNK pH 6.5 buffer [350 mM Tris-HCl pH 6.5, 50 mM MgCl2, 5 mM DTT], 1 μl PNK enzyme [NEB] ...
-
bioRxiv - Microbiology 2022Quote: ... washing and TRIzol extracted followed by removal of the 5’ cap with 10 U of 5’-pyrophosphohydrolase (RppH) (NEB) and 5’ end repair with T4 PNK (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... AMX sequencing adaptors were ligated by mixing 2.5 ul of the assembly mix with 5 ul AMX and 5 ul Blunt/TA mastermix from NEB and incubated for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Genomics 2024Quote: For a typical blunting reaction 5-50 ng of cfDNA are mixed with 5 μl of CutSmart 10x (NEB), 5 μl of dNTPs 1mM each ...
-
bioRxiv - Neuroscience 2024Quote: ... After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’) using T4 RNA ligase 1 (New England Biolabs; M0204S), the RT primer was annealed to the 3’-adapter ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... The DCR1 ORF along with its upstream and downstream sequence was amplified (primers: DCR1-Intergenic-For 5′-CCCCCTCGAGTTTGTAAAGAAATTGATGCTTCG; DCR1-Intergenic-Rev 5′-TGCAGGATCCGAATCTGGTATGGGATCATATTGG) and inserted between the XhoI and BamHI (NEB) restriction sites of pRS402.
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were end-repaired and T-tailed with Klenow fragment lacking 5’ → 3’ and 3’ → 5’ exonuclease activity (NEB). In-house adapters containing 8-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB). The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE ...
-
bioRxiv - Cancer Biology 2019Quote: ... PCR amplification of the target locus (forward primer: 5’-GGTTCTCAGTGCACGCATTT-3’; reverse primer: 5’-ACAACGATTTTCCTGGCATCT-3’) with Q5 polymerase (NEB), and Sanger sequencing of PCR products by the Keck Biotechnology Resource Laboratory at Yale ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... and DNA fragments were amplified by PCR with NEXTFlex primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) and further purified with AMPure XP beads to eliminate unligated primers and adapters ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 µL of the boiled colony was used for PCR with primer pair (JGI_27F: 5’-AGAGTTTGATCCTGGCTCAG-3’and JGI_1391R: 5’-GACGGGCRGTGWGTRCA-3’) with NEB Q5 Polymerase (New England Biolabs, Ipswitch, MA). The PCR amplicon was confirmed by agarose gel electrophoresis and the sequence was determined using conventional Sanger Sequencing (Genewiz LLC ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped by incubating at 65°C for 5 min followed by addition of 5 mM MgCl2 and 0.5 units of Shrimp Alkaline Phosphatase (rSAP, NEB M0371S). The phosphatase reaction was incubated at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... RJ-167-mer and RJ-5’Tail-167mer were radiolabeled with 32P at the 5′-end using T4 Polynucleotide Kinase (NEB). To generate the 3′ Tail and dsDNA DNA substrates ...
-
bioRxiv - Cell Biology 2022Quote: ... The 229E Spike cDNA was amplified by PCR with the forward primer: 5’-TTTTTTGCGGCTAGCATGTTCGTGCTGCTGG and the reverse primer: 5’-TTTTTTGCGCTCGAGTCACGCCGGCGCCACCTGGCTGGTTTCGGTCTGGATGTGGATC TTTTCCA using Phusion polymerase (New England Biolabs) according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2019Quote: ... The AGO1 ORF along with its upstream and downstream sequence was amplified (primers: AGO1-Intergenic-For 5′-GCTGGAGCTCTGAACGTGTGGAAGACCAAA; AGO1-Intergenic-Rev 5′-ATGACTCGAGAGTGGCTAACGGCAACATATC) and inserted between the SacI and XhoI (NEB) restriction sites of pRS404 ...
-
bioRxiv - Microbiology 2021Quote: ... forward and reverse primer for GFP (forward 5’TCGACAGTCAGCCGCATCT3’ and reverse primer 5’CCGTTGACTCCGACCTTCA3’) respectively using 1μl taq polymerase (NEB, USA). The PCR amplification was performed as per the following cycle ...
-
bioRxiv - Genetics 2022Quote: ... was assessed via PCR amplification using OneTaq 2x Master Mix (forward primer DLO1142 5’-ACCCATTTCCCATTCAATCA-3’ reverse primer DLO1143 5’-TTGTAATCTGCCCCAAAAGG-3’) and subsequent HpaII restriction digest (New England Biolabs). DLW135 carried a wild type allele of pho-9 ...
-
bioRxiv - Cell Biology 2019Quote: ... and pcDNA4/TO (forward primer 5’ GACACGTGAGAGGGAGTAGAAGCCGCTGATCAGCCTCGACTG 3’ and reverse primer 5’ CAATGGGGCGGAGTTGTTAC 3’) PCR products were assembled using Gibson Assembly (New England Biolabs) [36] ...
-
bioRxiv - Genetics 2019Quote: ... forward (5’-AAGCCAAGTCTGCATGAGTA-3’) and reverse (5’-TAAATGTGCCACTGACTAAAT-3’) followed by a restriction enzyme digestion with Sau96I (New England Biolabs) at 37ºC for 2-3 hours ...
-
bioRxiv - Neuroscience 2019Quote: ... encoding full length Ppp3cc was amplified with primers 5’- AGATTACGCTATCTGTACAGAATTCACCATGTCCGTGAGGCGC-3’ and 5’-GGCCGCTAGCCCGGGTACCGAATTCTTACAGGGCTTTCTTTCCATGGTC-3’ and inserted into pCAG-HA vector using NEB Builder (NEB).