Labshake search
Citations for New England Biolabs :
601 - 650 of 764 citations for Anti SDF 4 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... mCherry and control (GAPDH) expression levels were measured separately by qPCR from 4 uL of diluted cDNA using Taq DNA Polymerase (NEB, #M0270L), dsGreen DNA detection dye (Lumiprobe ...
-
bioRxiv - Neuroscience 2022Quote: ... Three to four independently generated PCR products for each OT1-4/founder were purified using the Monarch PCR & DNA Cleanup Kit (NEB Inc.) and sent for Sanger sequencing at the OHSU Vollum Sequence Core.
-
bioRxiv - Microbiology 2022Quote: ... Purified protein (4 μg) was deglycosylated with 500 U of Endoglycosidase H (Endo H) (New England Biolabs, Ipswich, MA, United States) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... with a terminal elongation step for 4 min at 72°C employing a proofreading Taq polymerase (Q5 High-Fidelity DNA polymerase, New England Biolabs, Germany). After verification of the amplicon sequence ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Genetics 2023Quote: ... 4 µg of DNA in 80 µl reaction were incubated at 37°C for seven minutes and randomly fragmented to 300 bp – 4 kb size products using NEBNext® dsDNA Fragmentase (New England BioLabs) and then cleaned using 0.5x SPRI beads ...
-
bioRxiv - Genomics 2023Quote: ... cells were then pelleted at 500xg for 2 min at 4°C and then resuspended in 200 μl of 1 × T4 DNA ligase buffer (NEB, B0202S) containing 0.2% SDS ...
-
bioRxiv - Genetics 2023Quote: ... After 48 h cells were incubated for 30 min at 37 °C with SNAP-Oregon green (NEB, final concentration 4 µM). Cells were then incubated for 30 min at 37 °C in fresh media to wash off unbound substrate ...
-
bioRxiv - Cancer Biology 2023Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml Tris buffer (10 mM Tris HCl (pH 8.0)) ...
-
bioRxiv - Microbiology 2023Quote: ... Digestion products were diluted by the addition of 4 mL 1.1× T4 DNA Ligase Reaction Buffer (New England BioLabs® Inc) with 1% Triton X-100 and incubated for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μg of venom in 10 µL of reducing SDS-PAGE buffer (6X stock solution, NEB B7024S with 30% β-mercaptoethanol) was run per lane on BioRad™ Mini PROTEAN pre-cast TGX acrylamide gels (15 well ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNase III-treated samples were pre-incubated with 4 U of RNase III (New England Biolabs, Ipswich, Massachusetts, USA, M0245S) in reaction supplemented by 20 mM MnCl2 at 15 °C for one hour ...
-
bioRxiv - Microbiology 2024Quote: ... acidocaldarius DSM 639 wild type using the primers (Eurofins Genomics) listed in supplementary Table 4 employing the Q5 polymerase (NEB, USA) following the manufacturers’ instructions ...
-
bioRxiv - Microbiology 2024Quote: ... the purified PCR products were ligated with the empty vectors in a molar ratio of 1:4 using T4 DNA ligase (NEB, USA) at 16 °C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatants were immunoprecipitated overnight with 40 µL of precoated anti-IgG magnetic beads (goat anti-rabbit IgG magnetic beads, NEB) previously incubated with the antibody of interest for 4 h at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primary antibodies used were from Cell Signalling Technologies (New England BioLabs, ON, CAN). They included phosphorylated and total extracellular signal-regulated kinase (P-ERK 1/2 ...
-
bioRxiv - Biochemistry 2022Quote: The plasmid CM13d3 (Antibody Design Labs) was digested with SacI (New England Biolabs) for 10 hours at 37 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... or anti-H3K9bhb (PTM Biolabs cat # PTM-1250) diluted 1:2,000 in blocking solution ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-SNAP-tag (P9310, New England BioLabs), rabbit anti-beta-tubulin (NB600-936 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-MBP (New England Biolabs, RRID:AB_ 1559738), used at 1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Pan anti-trimethyllysine (rabbit, PTM Biolabs, PTM-601), SETD2 (rabbit ...
-
bioRxiv - Cell Biology 2019Quote: ... or rabbit anti-GAPDH (2118S NEB, 1:5000) primary antibody with horseradish peroxidase-conjugated anti-mouse or anti-rabbit (Dianova 1:10,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-insulin was from Sigma (I-2018) and anti-SNAP from NEB (P9310S). The coverslips were mounted on glass slides with VectaShield Antifade Mounting Medium and fixed with nail polish ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-Gaussia luciferase (E8023, New England Biolabs) at a 1:2,000 dilution ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse anti-PPARα (1:25, Arigo Biolabs ARG55240). Alexa Fluor conjugated secondary antibodies (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-malonyl-lysine (PTM Biolabs, Cat. #PTM-901), anti-succinyl-lysine (PTM Biolabs ...
-
bioRxiv - Immunology 2022Quote: ... and pan anti-acetyllysine (PTM-105, PTM Biolabs).
-
bioRxiv - Molecular Biology 2022Quote: ... anti-glutaryl-lysine (PTM Biolabs, Cat. #PTM-1151), anti-ACC (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-succinyl-lysine (PTM Biolabs, Cat. # PTM-401), anti-glutaryl-lysine (PTM Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti-H4K12la (PTM BIOLABS, 1:1000, PTM1411RM). The next day ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-succinyllysine (PTM Biolabs, PTM-401, 1:1000), anti-MYC (and anti-SUCLG2 (Bethyl Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... The cloning reaction consists of 25 cycles of 3 min at 37°C for digestion and 4 min at 16°C for ligation combining the restriction enzymes BsaI-HF (New England BioLabs, Ipswich, UK) for level 1 reaction or BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... by random priming without denaturation with 4 mg random nonamer oligo (Integrated DNA Technologies, Skoie IL) and 10 units of Klenow (New England Biolabs, Ipswich, MA). Unincorporated dye was removed with Microcon columns (30 kDa MW cutoff ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA ligase reaction buffer (New England Biolabs, NEB, Ipswich, Massachusetts, US), 0.5 μl dATP (10mM ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA ligase reaction buffer (New England Biolabs, NEB, Ipswich, Massachusetts, US), 0.5 μl dATP (10mM ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana IMPa-4 fragment were used for genomic PCR and followed by digestion with BamHI and XhoI (New England Biolabs, Ipswich, MA). The pTRV2 vector (ABRC ...
-
bioRxiv - Neuroscience 2022Quote: ... Supplementary Table 4) from each sample was further processed with the Illumina NEBNext Ultra II Directional RNA Library Prep Kit (NEB #E7760S/L) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... and the library was amplified 4 cycles by PCR using Phusion high-fidelity PCR master mix with HF buffer (New England Biolabs cat. #M0531L). Finally ...
-
bioRxiv - Neuroscience 2022Quote: ... or medium that were pulled down with heparin-agarose (0.5 ml) were denatured and incubated with Arthrobacter ureafaciens sialidase (Nacalai Tesque, 4 milliunits) and/or O-glycosidase (New England BioLabs, 80,000 units), or peptide N-glycanase (PNGase ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were incubated at 16 °C for 4 h in the presence of 1.15x of T4 ligation buffer (New England Biolabs, catalog no. B0202S) and 100U T4 ligase ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was extracted from homogenized cell lysate by 4 × 250 µL/brain Oligo (dT)25 magnetic beads (New England Biolabs, Cat: S1419S), and immunoprecipitated (IP ...
-
bioRxiv - Genomics 2023Quote: ... Illumina libraries for all 4 isolates were constructed using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs Inc., USA) as per standard protocol and sequenced using the Illumina MiSeq and NextSeq500 platforms (paired end ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 12 cycles of 95°C for 15 seconds and 60°C for 4 min followed by exonuclease I (New England Biolabs, PN M0293S) treatment at 37°C for 30 minutes and 80°C for 15 minutes to remove any unincorporated primers ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was ligated for 4 h in a water bath at 16 °C (30 Weiss Units of T4 DNA Ligase, M0202 New England BioLabs® Inc). 300 μg of Proteinase K was used to reverse the cross-linking overnight at 65°C ...
-
bioRxiv - Microbiology 2024Quote: ... GM16 genomic DNA using primers SA-Reg FWD and SA-Reg REV (Table 4) and polymerase Q5 (New England Biolabs, Massachusetts, USA). The destination plasmid pGW44 [33] was linearized using primers pGW44 FWD and pGW44 REV ...
-
bioRxiv - Biophysics 2021Quote: ... PfK5ΔL6-MD-SNAP was biotinylated or fluorescently labelled by overnight incubation at 4°C with SNAP-Biotin® or SNAP-Surface® Alex Fluor® 647 (New England BioLabs) with at least a 3:1 molar excess of these labels to PfK5ΔL6-MD-SNAP ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequences are listed in Supplementary Table 4) and cloned into pGL3-TK-5UTR-BsmBI-Luciferase using BsmBI (New England BioLabs; Whitby, Ontario, Canada). The “Snail 417” UTR insert was generated by PCR using the forward primer TATCGTCTCAACACCGAGCGACCCTGCATAAGCTTGGCGCTGAGCCGGTGGGCG and the reverse primer ATACGTCTCTCTTCCATAGTGGTCGAGGCACTGGGGTCG ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR was also performed on RNA extracted from the 4 dpi lung samples with NEB Luna Universal One-Step RT-qPCR Kit with SYBR-Green (NEB, Ipswich, MA, USA) to quantify the cytokines IL-6 and IFN-β ...