Labshake search
Citations for New England Biolabs :
101 - 150 of 9137 citations for Anti M ZAP Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using M-MuLV Reverse Transcriptase (NEB) enzyme ...
-
bioRxiv - Cell Biology 2020Quote: ... Interacting MBP-AtPIP5K2 protein was detected using an anti-MBP antibody (NEB). Protein input was detected using an anti-GST antibody (GE Healthcare).
-
bioRxiv - Molecular Biology 2020Quote: ... antibody were incubated with 25 µL of magnetic anti-mouse beads (NEB) overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... and tumbled with 5 μg of anti-m6A antibody (New England Biolabs) at 4°C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies used in the study were: anti-acetylated lysine (PTM Biolabs, 1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated with anti-mouse HRP antibody (1:5000, NEB 7076S) for 1h at room temperature ...
-
bioRxiv - Physiology 2023Quote: ... Primary antibodies used targeted pan anti-β-hydroxybutyryllysine (PTM Biolabs, PTM-1201) or anti-amyloid-β1-16 (BioLegend 6E10 ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.8 M guanidine HCl) was supplemented with Proteinase K (New England Biolabs), diluted to 8 units mL-1 ...
-
bioRxiv - Microbiology 2020Quote: ... and pAAVS1_c- LTatCL[M]) were linearized using 100 units of NsiI (NEB)/20 μg DNA ...
-
bioRxiv - Plant Biology 2021Quote: ... AT5G02330 and AT2G13900 cDNA was synthesized using M-MuLV Reverse Transcriptase (NEB) with 100 ng of total RNA at 42ºC for 60 min ...
-
bioRxiv - Microbiology 2019Quote: ... First-strand cDNA synthesis was performed using M-MLV reverse transcriptase (NEB) wherein the 3’ adapter served as a primer ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µg of RNA digested with DNaseI (NEB, Frankfurt a. M., Germany) was used for reverse transcription of mRNA with the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mM dNTPs and 200 U M-MuLV (New England BioLabs, USA) which were treated following manufacturer’s instructions with some modifications ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 M NaCl and 8 units/ml Proteinase K (New England Biolabs) in 1x PBS] ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Plant Biology 2022Quote: ... Each MBP-tagged RAPTOR1B fragment was detected with anti-MBP antibodies (NEB, E8032S). For the in vitro kinase assay ...
-
bioRxiv - Microbiology 2021Quote: ... The membrane was probed with horseradish peroxidase (HRP)-conjugated anti-MBP antibody (NEB) and HRP-conjugated anti-FLAG antibody to detect MBP-TcpB and FBXO22 ...
-
bioRxiv - Biochemistry 2021Quote: ... membranes were probed with rabbit polyclonal anti-pansuccinyllysine antibody (PTM Biolabs, PTM-401) at a dilution of 1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 30 minutes in PBS containing the primary antibodies: rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs, Hangzhou, China), mouse monoclonal anti-tubulin β3 (801201 ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was reverse-transcribed with M-MuLV reverse transcriptase (New England Biolabs, M0253) and random hexomers (ThermoFisher N8080127) ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA was reverse transcribed using M-MuLV reverse transcriptase (New England Biolabs) following the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2021Quote: ... yielding almost 1.6 M mapping-quality variants (homozygous in NEB, absent from WUS). ddRADseq libraries were de-multiplexed and barcodes removed and variants called using a GATK 4.0 best practices pipeline29 ...
-
bioRxiv - Genomics 2019Quote: ... 0.25 M sucrose for digestion with Micrococcal Nuclease (M0247, New England Biolabs NEB). After 15 min digestion at RT ...
-
bioRxiv - Genomics 2019Quote: ... 0.25 M sucrose for digestion with Micrococcal Nuclease (M0247, New England Biolabs NEB). After 15 min digestion at RT ...
-
bioRxiv - Plant Biology 2020Quote: ... The cDNA was synthesized using the M-MLV RTase (New England Biolabs Japan) and subjected to the real-time qPCR using StepOnePlus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Cell Biology 2019Quote: ... First-strand cDNA synthesis was performed using M-MuLV Reverse Transcriptase (NEB M0253S) according to manufacturer’s recommendations with either oligo(dT ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.75 µl 0.1 M DTT and 0.3 U/µl T4 Polynucleotide kinase (NEB), and then incubated at 37°C 30 min ...
-
bioRxiv - Plant Biology 2022Quote: ... was used for cDNA preparation using M-MuLV Reverse Transcriptase (New England Biolabs). The cDNA sequence of TRB5 was amplified using gene specific Gateway-compatible primers according to the manufacturer’s instructions with primers specified in Supplemental Table 4 ...
-
bioRxiv - Neuroscience 2023Quote: ... and reversely transcribed into complementary DNA (cDNA) using M-MuLV reverse transcriptase (NEB.M0253S ...
-
bioRxiv - Immunology 2024Quote: ... cDNA was synthesized from mRNA samples with M-MLV (New England Biolabs, M0253S) primed with random hexamers (Life Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... followed by Alexa Fluor 488 goat anti-rabbit secondary antibody (New England Biolabs, UK) for 1h ...
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... Cells were then incubated for 1 hour with anti-MBP antibody (New England BioLabs) solution diluted in calcium containing blocking buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... Fgfrb-eGFP signal was detected using an anti-GFP antibody (TP401, Torrey Pine Biolabs) in combination with nuclear (Hoechst ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... first-strand complementary DNA (cDNA) was synthesised using M-MuLV Reverse Transcriptase (NEB, USA). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cDNA was synthesized using M-MuLV reverse transcriptase enzyme (New England Biolabs #M0253S) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: 1.5 μg of RNA was reverse transcribed using M-MuLV Reverse Transcriptase (NEB M0253L) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of 0.1 M Dithiothreitol (cat. n° M0368L, NEB, New England Biolabs, USA), 1 µL of 10 mM dNTP (cat ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of 0.1 M Dithiothreitol (cat. n° M0368L, NEB, New England Biolabs, USA), 1 µL of 10 mM dNTP (cat ...
-
bioRxiv - Plant Biology 2021Quote: ... First-strand cDNA was synthesized using oligo(dT) and M-MuLV reverse transcriptase (NEB). Real-time qPCR was performed using PowerUp™ SYBR™ master mix (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... then 1µl M-MLV reverse transcriptase enzyme was (New England BioLabs, Catalogue no.-M0368) added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized with M-MuLV Reverse Transcriptase (200 U/μL, New England Biolabs). Real-time PCR was performed by a CFX-96 real-time system (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... and converted to cDNA using random primers and M-MuLV RT-PCR enzyme (NEB). Proinsulin-specific primers (GTGAACCAGCACCTGTGC Fw and CGGGTCTTGGGTGTGTAGAAG Rv ...
-
bioRxiv - Cancer Biology 2024Quote: ... Equal amounts of RNA were transcribed with reverse-transcription (M-MuLV Reverse Transcriptase, NEB). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Bioengineering 2021Quote: ... Antibodies used for targeted depletion were prepared using goat anti-rabbit magnetic beads (NEB, S1432S) following the manufacturer’s protocol ...