Labshake search
Citations for New England Biolabs :
51 - 100 of 327 citations for Anti IL 13 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Interacting MBP-AtPIP5K2 protein was detected using an anti-MBP antibody (NEB). Protein input was detected using an anti-GST antibody (GE Healthcare).
-
bioRxiv - Molecular Biology 2020Quote: ... antibody were incubated with 25 µL of magnetic anti-mouse beads (NEB) overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... and tumbled with 5 μg of anti-m6A antibody (New England Biolabs) at 4°C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies used in the study were: anti-acetylated lysine (PTM Biolabs, 1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated with anti-mouse HRP antibody (1:5000, NEB 7076S) for 1h at room temperature ...
-
bioRxiv - Physiology 2023Quote: ... Primary antibodies used targeted pan anti-β-hydroxybutyryllysine (PTM Biolabs, PTM-1201) or anti-amyloid-β1-16 (BioLegend 6E10 ...
-
bioRxiv - Neuroscience 2021Quote: ... and PCR amplified for 13 cycles with Illumina Nextera adapter primers using the NEBNext High Fidelity 2X Master Mix (NEB) with the following PCR program ...
-
bioRxiv - Molecular Biology 2022Quote: ... regions flanking each target site were PCR amplified using locus-specific primers bearing tails complementary to the TruSeq Illumina adapters as described previously.13 25-50ng input genomic DNA is PCR amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs): (98°C ...
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription (IVT) was performed at 37°C for 13-16h with the HiScribe T7 RNA Polymerase kit (NEB). The remaining DNA was digested by Turbo DNase I (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Then barcodes from the Native Barcoding Expansion 1-12 & 13-24 from Oxford Nanopore Technologies (ONT) were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA was purified using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2019Quote: ... we used the miRNA quantifications from all brain libraries with all starting amounts using both batches (total of 99 libraries, 19 for the Clontech, NEXTflex, Deduped and Fivepercent methods and 10 for Illumina and 13 for NEB). We normalized the data using the DESeq2(40 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pre-amplified PCR products were transferred to 96-well plates and further amplified for an additional 13 cycles using custom Nextera dual-index primers and NEBNext High-Fidelity 2X PCR master mix (New England Biolabs). Individually barcoded libraries were pooled and purified on a single MinElute column (Qiagen) ...
-
bioRxiv - Immunology 2022Quote: ... Then 13 μl PCR heteroduplexes were digested by 2 μl of 1 U/μL T7 Endonuclease I (New England Biolabs) at 37°C for 60 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Barcodes from the Native Barcoding Expansion 1-12 & 13-24 from ONT were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA was purified using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2023Quote: ... and JSW-SS-34:41 (AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN TCGTCGGCAGCGTC) to amplify libraries for 11-13 cycles using Phusion High Fidelity PCR Master Mix (NEB) instead of the Illumina-supplied PCR reagents ...
-
bioRxiv - Microbiology 2023Quote: ... barcodes from the Native Barcoding Expansion 1-12 & 13-24 from Oxford Nanopore Technologies (ONT) were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA purifications were made using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2023Quote: ... and amplified using ISOSDB412 IS-Seq Step1 and p7 primers for 13 cycles using Q5 Master Mix (New England Biolabs). The products of this reaction were amplified with IS-Seq Step2 and p7 primers for 9 cycles using Q5 Master Mix and sequenced on a Novaseq 6000 at Novogene (Sacramento ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Plant Biology 2022Quote: ... Each MBP-tagged RAPTOR1B fragment was detected with anti-MBP antibodies (NEB, E8032S). For the in vitro kinase assay ...
-
bioRxiv - Microbiology 2021Quote: ... The membrane was probed with horseradish peroxidase (HRP)-conjugated anti-MBP antibody (NEB) and HRP-conjugated anti-FLAG antibody to detect MBP-TcpB and FBXO22 ...
-
bioRxiv - Biochemistry 2021Quote: ... membranes were probed with rabbit polyclonal anti-pansuccinyllysine antibody (PTM Biolabs, PTM-401) at a dilution of 1:1000 ...
-
bioRxiv - Biochemistry 2024Quote: ... 13 nt long RNA was radiolabelled at the 5’-end with [γ-32P] ATP and T4 Polynucleotide kinase (New England Biolabs) prior to complexes assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... A 13 nt RNA oligonucleotide was radiolabeled at the 5’ end with [γ-32P] ATP and T4 polynucleotide kinase (New England Biolabs) prior to EC assembly ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 30 minutes in PBS containing the primary antibodies: rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs, Hangzhou, China), mouse monoclonal anti-tubulin β3 (801201 ...
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed in 25 μL reaction volumes and contained 13 μL Q5® Hot Start High-Fidelity 2× Master Mix (New England Biolabs, US), 0.5 μM of each primer and 0.4 μL of 25 mg/mL BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 10 ng of library DNA was amplified with the p7 primer and the IS-Seq Step1 primer (Table S5) for 13 cycles using Q5 2X Master Mix (New England Biolabs, Ipswich, MA). These reaction products were diluted 1:100 and 10 µL was added to a PCR reaction with the p7 primer and the IS-Seq Step2 primer for 9 cycles using Q5 2X Master Mix ...
-
bioRxiv - Microbiology 2019Quote: ... followed by Alexa Fluor 488 goat anti-rabbit secondary antibody (New England Biolabs, UK) for 1h ...
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... Cells were then incubated for 1 hour with anti-MBP antibody (New England BioLabs) solution diluted in calcium containing blocking buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... Fgfrb-eGFP signal was detected using an anti-GFP antibody (TP401, Torrey Pine Biolabs) in combination with nuclear (Hoechst ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2022Quote: In vitro transcription/translation by codon skipping of the short FLAG tag-containing peptides X-Val-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (XV-Flag) where X = 7, 13, 14, or 15 was carried out using the PURExpress® Δ (aa, tRNA) Kit (New England Biolabs, E6840S) based on a previous protocol with slight modifications 16 ...
-
bioRxiv - Genomics 2023Quote: ... Amplification of the libraries was performed for 13 PCR cycles using the Phusion High-Fidelity PCR Master Mix (New England Biolabs, cat. no. M0531L); 6-bp molecular barcodes were also incorporated during this PCR amplification ...
-
bioRxiv - Molecular Biology 2023Quote: ... and produced by PCR amplification (10–13 cycles) of tagmented DNA using a NEB Next High-Fidelity 2× PCR Master Mix (New England Biolabs, Ipswich, MA, USA). DNA fragments were then purified using the MinElute PCR Purification Kit and eluted in 10 µL elution buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... Antibodies used for targeted depletion were prepared using goat anti-rabbit magnetic beads (NEB, S1432S) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... and lysine crotonylation was detected using a pan-specific anti-CrK antibody (PTM Biolabs, PTM105), both were used according to manufacturer’s specifications.
-
bioRxiv - Neuroscience 2023Quote: ... The primary antibodies used were anti-PDGF-Ra (rabbit, New England Biolabs, 1:400 dilution), anti-APC (clone CC1 ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was then probed with the primary anti-MBP antibody (NEB E8032S, 1:10000) diluted in 5% NFDM (overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... the membrane was incubated with HRP-conjugated secondary antibody (goat anti-rabbit HRP, BioLabs 7074P2) in 3% BSA in PBS-T shaking for 1-2 h at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... The commercial antibodies used in this study are Pan anti-butyryllysine (PTM Biolabs, SKU: PTM 301), Butyryl-Histone H4 (Lys 12 ...
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: Lysine-succinylated peptides were enriched using agarose-conjugated pan anti-succinyllysine antibody (PTM Biolabs, Hangzhou, China). In brief ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies used for immunoblots in this study were anti-tau (tau46) (1:5000; NEB 4019S), anti-human tau (tau13 ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Cell Biology 2019Quote: ... then incubated with either mouse anti-MBP antibodies at a dilution of 1:5000 (New England Biolabs) or 1:2500 mouse anti-GFP antibodies (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... The primary antibodies used in this study were rabbit anti-GLuc 1:2,000 (E8023S, New England Biolabs), rabbit anti-epidermal growth factor receptor (EGFR) ...
-
bioRxiv - Microbiology 2019Quote: ... overnight at 4°C followed by Alexa Fluor 488 goat anti-rabbit secondary antibody (New England Biolabs, UK) for 1h ...
-
bioRxiv - Cell Biology 2021Quote: SNAP-GCGR was detected with an anti-SNAP-tag rabbit polyclonal antibody (P9310S, New England Biolabs, 1/500) followed by goat anti-rabbit IgG H&L HRP (ab6271 ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... was detected by addition of 1 nM Europium-labeled anti-p53 phosphoserine 15 antibody (New England Biolabs/ Cisbio) and 40 nM streptavidin-conjugated APC (Prozyme ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were incubated with primary antibody rabbit anti-c-Fos (1:3000, New England Biolabs cat. No. 2250S) for 24 hours at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... m6A pulldown was performed with a rabbit monoclonal anti-m6A antibody in the EpiMark N6-Methyladenosine Enrichment Kit (NEB) according to the manufacturer’s protocol ...