Labshake search
Citations for New England Biolabs :
1 - 50 of 3324 citations for Ammonium Polyphosphate phase II 02 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 10% of these RNAs were decapped and polyphosphates reduced to monophosphates using RppH (NEB) to sequence all small RNAs (sRNA-seq).
-
bioRxiv - Systems Biology 2022Quote: ... Protoscript II and Protoscript II Reaction Buffer (NEB, M0368L) as well as murine RNase-Inhibitor (NEB ...
-
bioRxiv - Genomics 2021Quote: ... ProtoScript II (NEB), and 1 μg input of total RNA ...
-
bioRxiv - Microbiology 2023Quote: ... Protoscript II (NEB) and 0.1M DTT ...
-
bioRxiv - Genetics 2024Quote: ... ProtoScript II (NEB), and 1 μg of total RNA input.
-
bioRxiv - Molecular Biology 2024Quote: ... heparinase II (NEB), and heparinase III (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... ProtoScript II (200units, NEB) and DTT (5mM) ...
-
bioRxiv - Biochemistry 2020Quote: ... heparinase II (NEB #P0736), and chondroitinase ABC (Sigma-Aldrich #C3667 ...
-
bioRxiv - Neuroscience 2021Quote: The ProtoScript II (NEB) reverse transcription system was used to create cDNA from RNA samples ...
-
bioRxiv - Cell Biology 2021Quote: ... or ProtoScript II (NEB). Quantitative real-time PCR was run using SYBR green on a CFX Connect system (Biorad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Protoscript II (NEB) per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... heparinase II (NEB, P0736S) and heparinase III (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and Protoscript II RT (NEB). 10 μl of cDNA was PCR amplified for 18 cycles with Illumina TruSeq primers and Phusion DNA polymerase ...
-
bioRxiv - Cell Biology 2022Quote: ... and 200U Protoscript II (NEB). cDNAs were circularized using 100U CircLigase I ssDNA ligase (Epicentre) ...
-
bioRxiv - Genomics 2021Quote: ... NEB Ultra II (NEB, 7645S) reagents were used following the manufacturer’s protocol with the following deviations ...
-
bioRxiv - Genomics 2021Quote: ... while ProtoScript II (NEB Biolabs) was used for the Twist Bioscience workflow according to the details given in the Twist Bioscience Library Preparation protocol ...
-
bioRxiv - Genomics 2021Quote: ... while ProtoScript II (NEB Biolabs) was used for the Twist Bioscience workflow according to the details given in the Twist Bioscience Library Preparation protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... ii) 500U Endo H (NEB), or iii ...
-
bioRxiv - Molecular Biology 2022Quote: ... ProtoScript II (New England Biolabs), Recombinant HIV (Worthington ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein Deglycosylation Mix II (NEB) was added and further incubated for 30 min ...
-
bioRxiv - Bioengineering 2024Quote: ... deglycosylation mix II (P6044S NEB) was obtained from New England Biolabs (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... Protoscript II (New England Biolabs) was used to reverse transcribe RNA into cDNA as template for qPCR analysis using the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by NEB NEBNext Ultra II (NEB #E7760) or Illumina TruSeq library preparation and Illumina platform sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... HLA and neoantigen transduction: Constructs expressing HLA-A*02:01 were linearized and restricted with BamHI and XhoI (New England Biolabs) and purified using the Zymoclean Gel DNA Recovery Kit (Zymo Research Cat ...
-
bioRxiv - Immunology 2022Quote: ... The lyophilized samples were then resuspended in 50 mM ammonium bicarbonate buffer and digested with PNGaseF (New England Biolabs) for a total of 20 hours ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2uL of SuperScript II (NEB M0368L), and 2 uL of water ...
-
bioRxiv - Genomics 2020Quote: ... 0.75 µl Protoscript II (150U; NEB)] at 50°C for 1 hour ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Type IIs RE (0.5 μl, NEB), vector backbone and inserts were combined to make 10 μl ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcribed using Protoscript II (NEB), and quantified using qPCR with primers for renilla luciferase (forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Protoscript II (New England Biolabs) reverse transcriptase ...
-
bioRxiv - Molecular Biology 2020Quote: ... reverse transcribed using protoscript II (NEB) and RT primer oBZ408 (/5Phos/RNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSP18/TTC AGACGTGTGCTCTTCCGATCTGTCCTTGGTGCCCGAGTG) ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 units/ml Dpn II (NEB) in RE buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... ProtoScript II reverse transcriptase from NEB was used to generate cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... then USER II enzyme (NEB, M5509) was added to cleave the product followed by a second column purification (Zymo research ...
-
bioRxiv - Biochemistry 2023Quote: ... pomatia RNA with Protoscript II (NEB) and random primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... Once PCNA foci disappear the G2 phase starts and lasts until nuclear envelope breakdown (NEB). After apical mitosis ...
-
bioRxiv - Biochemistry 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H2O18 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H218O (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H2O18 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... were reinjected at 75 μl/h and co-flowed with 150 μl/h PCR mix (1.65x NEBNext Ultra II Q5 Master Mix, 0.033 U/μl USER II (NEB), 1.32 M Propylene glycol ...
-
bioRxiv - Genomics 2022Quote: ... Ultra II End-prep reaction buffer (NEB) and Ultra II End-prep enzyme mix (NEB ...
-
bioRxiv - Plant Biology 2021Quote: ... ProtoScript II reverse transcriptase (NEB; Cat#B0368) was used to generate cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5μl of 10x BstPol II buffer (NEB), 1.5μl of 10mM dNTPs ...
-
bioRxiv - Microbiology 2022Quote: ... the NEB Ultra II FS kit (NEB #E6177L ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR-amplified (NEBNext Ultra II Q5; NEB) using primers DCF01 5’-CTTGTGGAAAGGACGAAACACCG-3’ and DCR03 5’-CCTAGGAACAGCGGTTTAAAAAAGC-3’ and subjected to single-end 75 bp (SE75 ...
-
TIR signaling promotes the interactions between EDS1/PAD4 and ADR1-L1 and oligomerization of ADR1-L1bioRxiv - Plant Biology 2021Quote: ... ProtoScript II reverse transcriptase (NEB; Cat#B0368) was used to generate cDNA ...
-
bioRxiv - Neuroscience 2020Quote: Illumina compatible libraries were made from Visium derived cDNA using a modified protocol derived from NEB Ultra II DNA FS kit (NEB #E6177). Visium derived spatial cDNA was diluted to 100ng in 26μl and combined with 7μl NEBNext Ultra II FS Reaction Buffer and 2μl NEBNext Ultra II FS Enzyme Mix and incubated at 37°C for 15min ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.4 μl USER II (New England Biolabs) enzyme mix was added an the suspension incubated for 45 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Protoscript II Reverse Transcriptase (New England Biolabs) was used to make cDNA PCR templates from parasite RNA (Toxoplasma GT1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... (ThermoFisher Scientific SuperScript II, NEB random nonamers). The samples were purified with Ampure XP beads to isolate the cDNA and samples were eluted to 30µl ...