Labshake search
Citations for New England Biolabs :
1 - 50 of 921 citations for Amine oxidase flavin containing A MAOA Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... λex = 488 nm and λem = 526 nm were used for detection of covalently bound flavin and λex = 670 nm and λem = 633 nm for visualisation of the Blue Prestained Protein Standard (New England Biolabs).
-
bioRxiv - Microbiology 2020Quote: ... at λex = 488 nm and λem = 526 nm for detection of covalently bound flavin and at λex = 670 nm and λem = 633 nm for visualization of the Blue Prestained Protein Standard (NEB).
-
bioRxiv - Biophysics 2023Quote: ... Amine-modified DNA oligonucleotides (NH2/GTGATGTAGGTGGTAGAGGAA) were linked to the benzylguanine (BG; NEB), and BG-oligonuculeotides were labeled with myosin II containing a C-terminal SNAP-tag (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... The alkyne-PAR was purified to remove excess alkyne-PEG1-amine using the Monarch Nucleic Acid Cleanup Kit (NEB) following the recommended protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 30 minutes in PBS containing the primary antibodies: rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs, Hangzhou, China), mouse monoclonal anti-tubulin β3 (801201 ...
-
bioRxiv - Microbiology 2023Quote: ... containing ligase T4 (NEB), and its reaction buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... containing DNase I (New England Biolabs) and 1× cOmplete ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 0.2 mg/mL BSA (NEB), 180 μM dNTPs and 10 units of phi29 DNA polymerase (NEB ...
-
bioRxiv - Genomics 2020Quote: ... containing 1.25U E.coli PolyA (NEB M0276S), 1.25X PolyA buffer (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... containing 1x NEBuffer 2 (NEB, B7002S), 1 mM ATP ...
-
bioRxiv - Microbiology 2023Quote: ... containing 1x rCutSmart buffer (NEB, B6004S), and 5U of quick CIP (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5mM Spermidine) containing MNase (NEB, M0247S) to final concentration of final concentration of 20 U/µL and incubated at 37°C for 15 min ...
-
bioRxiv - Immunology 2022Quote: ... containing 5 U murine RNase Inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Immunology 2020Quote: ... containing 200 U PNGaseF (New England Biolabs) or buffer only ...
-
bioRxiv - Microbiology 2023Quote: ... containing 160 μM S-adenosylmethionine (SAM: NEB). This five-enzyme methylation cocktail was previously necessary to achieve genetic alteration in the strain as described in Umaña et al14.
-
bioRxiv - Immunology 2023Quote: ... containing 1 mM sodium orthovanadate (NEB, # P0758S). The membrane from the transwell inserts was cut using forceps and placed in 300 µL of 1X cell lysis buffer (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... containing protein inhibitor cocktail (New England Biolabs). Cell lysates were incubated on ice for 5 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 1 volume of λ-Phosphatase (NEB) with 1 volume of water ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing 2 pg of lambda-DNA (NEB, N3011S ...
-
bioRxiv - Molecular Biology 2020Quote: ... aqueous phase containing the barcoded cDNA (~50 μL) was combined with 50 μL digestion mix containing 5 μL ExoI enzyme (NEB), 5 μL HinFI enzyme (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... containing 25% v/v PEG 8000 (NEB, #B1004) and 20% v/v acetonitrile (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... containing a mix of oligonucleotides dT23VN (NEB, UK) and random hexamer primers (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... containing DNaseI (New England Biolabs, Ipswich, MA, USA) and protease inhibitor cocktail (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... For experiments containing linker histone H1.0 (NEB # M2501S), 1:1 ratio of H1:nucleosome was used ...
-
bioRxiv - Microbiology 2022Quote: ... containing T4 polynucleotide kinase (PNK; 0.2 μl; NEB) in a total volume of 10 μl to obtain double-stranded DNA flanked by XbaI and HindIII overhangs ...
-
bioRxiv - Cancer Biology 2022Quote: ... polyA-containing transcripts were enriched for (NEB #E7490S) and prepared into paired-end libraries (NEB #E7760S) ...
-
bioRxiv - Genomics 2024Quote: ... a ligation mix containing 1× T4 buffer (NEB) and 20 U/μl T4 DNA ligase (NEB ...
-
bioRxiv - Genetics 2024Quote: ... containing 2 U of T5 exonuclease (NEB, M0363S), 12.5 U of Phusion DNA polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 20 U/μL Exonuclease I (NEB, Cat #M0293), 20 U/μL HinfI enzyme (NEB ...
-
bioRxiv - Bioengineering 2020Quote: ... containing 12.4 U/uL RNase If (New England Biolabs) and 0.025 U/uL DNase I (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Effective sgRNA containing constructs were selected by T7E1 (NEB) cleavage assay following manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... containing 6,25µl of LongAmp Taq 2✕ Master Mix (NEB), 4,25µl of milliQ water ...
-
bioRxiv - Genomics 2023Quote: ... containing 9U of T4 DNA polymerase (NEB, Cat#M0203S) and 40μM dATG/dGTP and incubated at 20℃ for 4 hours to remove unligated fragments ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 0.4 U/ml RNAse inhibitor (New England Biolabs) and were immediately transported to the sequencing facility on ice for further processing.
-
bioRxiv - Biochemistry 2023Quote: ... in 15μl reaction volumes containing the Cutsmart buffer (NEB) or a reconstituted equivalent (50mM Potassium acetate ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1.5 μl of NEBuffer r2.1 (New England Biolabs). Finally ...
-
bioRxiv - Genomics 2024Quote: ... DNA polymerase I mix containing NEBuffer2.1 1X (NEB # B7002S), 30 µM of dNTPs (including dCTP/dGTP/dTTP (NEB # N0441S/ N0442S/N0443S respectively ...
-
bioRxiv - Biophysics 2020Quote: ... containing 0.2 mM ATP (New England Biolabs Inc., Ipswitch, MA) as well as 1.0 mM DTT (Carl Roth ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... SDS 0.5%) containing 0.5 μL Proteinase K (20mg/ml, NEB) at 50°C for 2hr ...
-
bioRxiv - Developmental Biology 2020Quote: ... a mix containing 2 μl of RNAse H (NEB, #M0297S), 1 μl of E ...
-
bioRxiv - Molecular Biology 2020Quote: ... The dUTP containing strand was degraded with USER enzyme (NEB) and beads were re suspended after washing in 20μl 10mM Tris-HCl pH8 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.5 μg RNA probe containing T7 RNA polymerase (NEB) transcribed NFIB 3’ UTR HP RNA or AR RNA / NFIB 3’ UTR RNA hybrid RNA as control ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 100 μg/mL RNase A (New England Biolabs, USA) for 15 min at 37°C and away from light ...
-
bioRxiv - Genetics 2021Quote: ... PCR reactions (50 µl) containing 1 × Q5 reaction buffer (NEB), 200 µM dNTPs ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5% NP-40) containing 2 μl RNase Inhibitor (M0314, NEB) and 10 μl m6A antibody (ab151230 ...
-
Circularization of rv0678 for genotypic bedaquiline resistance testing of Mycobacterium tuberculosisbioRxiv - Molecular Biology 2022Quote: Twenty microliter reactions containing 10U Exonuclease VIII truncated (NEB, USA) were set up according to the manufacturer’s instructions and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... pSNAPf vector containing SNAP-tag was purchased from NEB (N9183S) and optimised to Drosophila codon suing Genewiz (USA ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL containing 0.01 U Bst 2.0 DNA polymerases (NEB), 0.5 U SplintR ligase (NEB) ...