Labshake search
Citations for New England Biolabs :
301 - 350 of 2110 citations for Adenovirus Type 5 Particles CMV Luciferase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
mRNA vaccines and hybrid immunity use different B cell germlines to neutralize Omicron BA.4 and BA.5bioRxiv - Immunology 2022Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Microbiology 2022Quote: ... or exonuclease III (NEB, 5 units) were performed on 2 – 3 μg of DNA extracted from virus particles for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... coli NEB® 5-alpha (NEB) according to the instructions of the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BsaI-HFv2 (NEB, R3733L), 250 U T4-ligase and nuclease-free water for a total of 5 µl reaction mix ...
-
bioRxiv - Microbiology 2023Quote: ... and Adenosine 5’-Triphosphate (ATP) (NEB). After RNA recovery using an RNA MinElute Cleanup Kit (QIAGEN) ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL High GC Enhancer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL High GC Enhancer (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... 5 µl 10x CutSmart buffer (NEB), 1 µl PsiI enzyme (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... 5 uL 5X Phusion Buffer (NEB), 10 uL 1M Trehalose (Life Sciences Advanced Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL 5′deadenylase (NEB #M0331S), 1 µL of RiboLock (ThermoFisher #EO0381 ...
-
bioRxiv - Immunology 2023Quote: ... 5 µL of GC Enhancer (NEB), 5 µL of 5X buffer ...
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Genomics 2023Quote: ... or 5 U MboI (NEB R0147S) in 15 μl rCS buffer for 1 h at 37°C and analysed in a 1.2% agarose gel containing ethidium bromide ...
-
bioRxiv - Immunology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart 10x (NEB), 2 μl of BSA (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units of antarctic phosphatase (NEB), and 1 mM manganese chloride ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of Antarctic Phosphatase (NEB) and 10 mU/µL of phosphodiesterase I (PDEI ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation and transfected into BHK-21 cells using Lipofectamine 3000 for viral production ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Microbiology 2021Quote: ... Firefly luciferase (FLuc) RNA served as the spike in control and was generated using HiScribe T7 Quick RNA Synthesis kit (NEB, Ipswich, MA, USA) using linearized plasmid DNA encoding FLuc gene as template ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequences are listed in Supplementary Table 4) and cloned into pGL3-TK-5UTR-BsmBI-Luciferase using BsmBI (New England BioLabs; Whitby, Ontario, Canada). The “Snail 417” UTR insert was generated by PCR using the forward primer TATCGTCTCAACACCGAGCGACCCTGCATAAGCTTGGCGCTGAGCCGGTGGGCG and the reverse primer ATACGTCTCTCTTCCATAGTGGTCGAGGCACTGGGGTCG ...
-
bioRxiv - Microbiology 2024Quote: ... Purified amplicons were cloned into STARR-seq luciferase reporter vector within the XbaI and FseI sites using Gibson assembly master mix (NEB Cat. No. E5510). The STARR-seq luciferase reporter (vector_ORI_empty ...
-
bioRxiv - Microbiology 2019Quote: In vitro transcribed 3X-FLAG tagged manY transcripts – wild-type or Δenh (1 pmol) were translated in vitro using the PURExpress translation kit (NEB). Translation reactions were stopped by adding Laemmli sample buffer (Bio-Rad) ...
-
bioRxiv - Biophysics 2022Quote: ... single point mutations were introduced to the respective wild-type plasmids by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (NEB). The used primers are listed in table 1.
-
bioRxiv - Microbiology 2019Quote: ... were amplified from genomic Synechocystis 6803 wild type DNA using specific primers (Table S1) and Phusion Polymerase (New England Biolabs). After restriction digest with BamHI and NotI ...
-
Calibrated feedback illumination for precise conventional fluorescence and PALM imaging applicationsbioRxiv - Biophysics 2019Quote: ... Wild-type ADE2 was amplified from genomic DNA, RB201 (W303 MATa, trp1, leu2, ura3, his3, can1R, ADE2) with Phusion PCR (NEB) using the forward primer (ATGGATTCTAGAACAGTTGGTATATTGGGAGGGGGACAA ...
-
bioRxiv - Cell Biology 2019Quote: ... Genomic regions of about 1 kb were amplified from wild-type genomic lysates using Q5 Hot Start high-fidelity polymerase (New England Biolabs) with the following primers ...
-
bioRxiv - Genomics 2020Quote: We used the prepared DNA of each clone and the wild type gene for amplification by PCR with Q5 polymerase (NEB) using primers which included the minION barcodes adapters ...
-
bioRxiv - Biophysics 2021Quote: Wild-type MukB was 6×His-tagged at the C-terminus and was expressed from plasmid Pet21 in C3013I cells (NEB). For Immobilized His6-tagged MukB ...
-
bioRxiv - Biochemistry 2020Quote: ... Human wild-type TDP-43 was amplified in two separate PCR reactions excluding the NLS and reassembled using Gibson cloning (NEB) into a Doxycycline-inducible expression vector containing an N-terminal mClover3 tag ...
-
bioRxiv - Neuroscience 2019Quote: ... The R1320P mutation was created in a wild-type cDNA using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Wild-type and R1320P mutant dNf1 were then subcloned into the pUAST-attB vector with an in-frame C-terminal fusion with eGFP cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... CASP1 and CASP4 CDS were amplified from the obtained library and cloned into the pMSCV-puro vectors The caspase-4 catalytically dead C258A pMSCV-puro vector was generated from the wild-type pMSCV-puro-CASP4 through site-directed mutagenesis by PCR using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The CASP4 and GSDMD-targeting lentiviral vectors (pGIPZ ...
-
bioRxiv - Cell Biology 2020Quote: ... The open reading frame for a KIF18A wild-type siRNA resistant construct51 and pEM791 vector49 were amplified with primers designed for Gibson Assembly (New England BioLabs). After confirming the correct sequence of the Gibson assembled plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Biochemistry 2019Quote: ... Most point mutants and wild-type variants were generated from this vector following the Q5 Site-Directed Mutagenesis Kit protocol (E0554, New England Biolabs) and primers 1-8 (Sup ...
-
bioRxiv - Bioengineering 2020Quote: In-vitro digestion reactions were carried out with three different types of the Cas12a family (LbCas12a, AsCas12a, and FnCas12a were purchased from New England Biolabs Inc. ...
-
bioRxiv - Cell Biology 2021Quote: To generate inducible vectors for MST2 wild type and del EDG we amplified the Flag2x _Strep2x fused to the MST2 constructs (wild type and del_EDG) with Q5 High-Fidelity Polymerase (New England BioLabs, # M0492) using specific primers (EcoRI_Flag_Fw and MST2_AgeI_Rv ...
-
bioRxiv - Molecular Biology 2020Quote: ... Wild-type (wt) gRNA was in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... HDR plasmid with mutant me31B genes was generated by mutating the me31B wild type gene in the wildtype HDR donor plasmid by using the Site-Directed Mutagenesis kit (New England Biolabs) according to the manufacturer’s recommended protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μg of total RNAs from wild type LCL 25 and LCL MM were treated with DNAse I (M0303S-NEB), and reverse transcription was carried out with random hexamer primers (S0142-Thermo Scientific™ ...
-
bioRxiv - Biophysics 2022Quote: ... the assembled sequences were transferred to the target plasmids (WT, MUT) by using a different set of type IIS enzymes (BbvI, New England Biolabs #R0173 ...