Labshake search
Citations for New England Biolabs :
401 - 450 of 1213 citations for Adenovirus Type 40 Hexon Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Percoll-enriched DMSO or rapamycin-treated iRBCs (36 - 40 hpi) were DNA-stained with either Hoechst 33342 (New England Biolabs) or SYBRGreen and mixed in a 1:1 ratio in duplicate ...
-
bioRxiv - Developmental Biology 2023Quote: ... Large dsDNA donor molecules with ∼40 bp homology arms on each end were prepared by PCR using Q5 DNA Polymerase (New England BioLabs) and purified using HighPrep PCR Clean-up beads (MagBio ...
-
bioRxiv - Cancer Biology 2023Quote: ... or A3H Hap VII were added to the reactions together with 40 U of murine RNase inhibitor (NEB, Ipswich, Massachusetts). Activity of cell lysates was evaluated in reactions containing 43 nt or 85 nt linear or 21 nt hairpin substrates (Table S3) ...
-
bioRxiv - Biochemistry 2023Quote: ... Clarified lysates were incubated for 1 hour at 4 °C on a nutator with 40 µL amylose resin slurry (New England Biolabs) equilibrated with amylose wash buffer ...
-
bioRxiv - Microbiology 2024Quote: ... hepatitis delta virus (HDV) ribozyme and simian virus 40 (SV40) poly-A sequence using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) at 50 °C for 60 min ...
-
bioRxiv - Genomics 2022Quote: ... wild-type and mutant NEAT1 RNA fragments were transcribed in vitro using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, #E2040S) and labelled with Biotin using Biotin RNA Labelling Mix (Roche ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated for 30 minutes shaking at 1.500 rpm at room temperature with protein extract (500 µg of whole cell protein extract or 150 µg of CPE) and murine RNase Inhibitor (NEB) in the corresponding protein extraction buffer (without glycerol) ...
-
bioRxiv - Biophysics 2019Quote: ... uncleaved fractions and 3C protease were removed by Ni-chelated sepharose and the G protein was dephosphorylated by lambda protein phosphatase (NEB), calf intestinal phosphatase (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... was expressed as maltose-binding protein-tagged fusion protein using the pMAL(tm)c5X-vector (New England Biolabs, Ipswich, USA). The coding DNA sequence was amplified by PCR using gene-specific primers (for primer sequences ...
-
bioRxiv - Plant Biology 2021Quote: The MBP-NbERF-IX-33a fusion protein was prepared using the pMAL Protein Fusion and Purification System (New England Biolabs). E ...
-
bioRxiv - Plant Biology 2020Quote: ... and an aliquot containing 10 µg protein was treated with lambda protein phosphatase reaction mix following the instructions of the manufacturer (New England Biolabs) for 1 h at 30°C.
-
bioRxiv - Cell Biology 2019Quote: ... were expressed as fusion proteins with an N-terminal maltose binding protein (MBP)-tag using the pMALTMc5x-vector (New England Biolabs). Cloning was mediated by the addition of the restriction sites XmnI/PstI to the ends of gene fragments PCR-amplified from P ...
-
bioRxiv - Plant Biology 2023Quote: ... The MBP-OsTLP protein or the MBP control protein was bound to amylose resin (New England Biolabs, Beverley, MA, USA), and then the LssaCA-His protein was added to the beads ...
-
bioRxiv - Plant Biology 2024Quote: ... An aliquot containing 10 mg of protein was then subjected to lambda protein phosphatase reaction mix following the manufacturer’s instructions (New England Biolabs, US) for 1 hour at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 μL of magnetic beads protein A (NEB) were added to the mixture and incubated for 4 h at 4°C on a rotating wheel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were transferred to nitrocellulose membranes (Biolabs, 1620115). Membranes were then incubated with primary antibody diluted in 5% milk or 2.5% BSA in Triton X-100-TBS buffer (T-TBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... we injected Cas9 mRNA or protein (NEB, M0646T) with corresponding sgRNAs into 1-cell wild-type Tuebingen embryos ...
-
bioRxiv - Developmental Biology 2021Quote: Protein extraction was performed with RIPA buffer (NEB) in the presence of protease and phosphatase inhibitors (Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... Proteins with or without PNGase F (NEB, USA) digestion were mixed with the loading buffer (250Mm Tris-HCl PH 6.8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 90 nM of SpCas9 protein (New England Biolabs), Cas9 nuclease buffer (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... PNGase F (P0704, NEB, 1,000 units/µg protein) was used to remove the N-linked glycosylation in purified ORF8 protein ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were treated with Lambda Protein Phosphatase (NEB) for 30 min at 30 °C followed with an additional four times washing step before they were blocked ...
-
bioRxiv - Microbiology 2020Quote: ... and proteins were purified with amylose resin (NEB) and eluted with 20 and 50 mM maltose (Sigma).
-
bioRxiv - Plant Biology 2021Quote: ... All proteins were purified using Amylose Resin (NEB) or HisPur Cobalt Resin (Thermo ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10µl of Protein G magnetic beads (NEB, S1430S) was used ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1μl of T4 bacteriophage protein (NEB, 5ng/μl), 3μl of DMSO ...
-
bioRxiv - Molecular Biology 2019Quote: ... The protein was purified using amylose resin (NEB) using the provided protocol ...
-
bioRxiv - Pathology 2020Quote: ... plasma and histone H3 protein (New England Biolabs) as standard were subjected to SDS-PAGE and electrically transferred onto PVDF membrane (Millipore) ...
-
bioRxiv - Biophysics 2020Quote: ... Eluted protein was deglycosylated with PNGase F (NEB) by incubating 5 units of the enzyme per 1 μg of protein for 2 h at 37 °C under gentle agitation ...
-
bioRxiv - Developmental Biology 2020Quote: ... The gRNAs were mixed with protein Cas9 (NEB), allowed 5 minutes at 37°C to assemble into ribonucleoprotein complexes ...
-
bioRxiv - Microbiology 2019Quote: ... Lactis Protein Expression kit (New England Biolabs, UK) was used with the pKLAC2 vector ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 μL Protein G magnetic beads (NEB, S1430S) were used ...
-
bioRxiv - Cell Biology 2019Quote: ... The gRNA and Cas9 protein (New England Biolabs) were injected into one-cell stage NHGRI-1 embryos in a 2 nl volume consisting of ∼50 ng/μl gRNA and ∼300 nM Cas9 ...
-
bioRxiv - Cell Biology 2022Quote: ... were added to 1x protein kinase buffer (NEB) supplemented with 200 μM “cold” ATP (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribonucleoprotein complexes of SpCas9 protein (NEB; Ipswitch, MA), ssODN template and gRNA were prepared with final concentration 200 μg/μl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Broad Range Protein Marker (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... coli protein synthesis system (New England BioLabs inc.). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... and PMP with Lambda Protein Phosphatase (P0753S, NEB) with Phosphatase inhibitor cocktail (4X ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 units mL-1 lambda protein phosphatase (NEB), and 0.1 μg mL-1 protein phosphatase 2a (Cayman Chemical ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL of Lambda Protein Phosphatase (NEB, P0753S) was added to aliquots 3 and 4 (PPase only) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 µL of λ protein phosphatase (NEB P0753S) was added and incubated at 37°C for 30 minutes and then placed on ice ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proteins were purified by Amylose resin (NEB) and eluted with 10 mM maltose ...
-
bioRxiv - Biophysics 2023Quote: ... and phosphorylated with protein kinase A (PKA) (NEB) for 1 hour at 20 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 30nM sgRNA and 30 nM Cas9 protein (NEB) for 1h at room temperature and analyzing cleavage products on a 2% agarose gel ...
-
The RNA-binding protein RbpB is a central regulator of polysaccharide utilization in gut BacteroidesbioRxiv - Microbiology 2023Quote: ... coli protein synthesis system (PURExpress, New England Biolabs). Reactions were performed according to manufacturer’s instruction and as previously described in 82 with a few modifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... chromatin and RNA were digested in 100 µL MNase digestion solution (1x micrococcal nuclease (MNase) buffer and 40 units/µl MNase (NEB, #M0247)) for 5 min at 37 °C while shaking at 1,400 rpm in a thermomixer ...
-
bioRxiv - Genomics 2020Quote: ... 2 mM EDTA pH 8.0) was performed to obtain 40-70-nucleotide fragments that were subsequently size-selected and dephosphorylated with T4 PNK (NEB, M0201S) for ligation of a 3’ DNA linker containing a random hexamer molecular barcode to allow detection of PCR duplicates84 ...
-
bioRxiv - Genetics 2019Quote: ... 2 μl of genomic DNA was used as template in a 40 μL PCR reaction with LongAmp® Taq DNA Polymerase (NEB). The 415bp PCR fragment of white target was amplified with CGTTAGGGAGCCGATAAAGAGGTCATCC (w.sF ...