Labshake search
Citations for New England Biolabs :
201 - 250 of 1836 citations for 9 10 12 13 tetrahydroxyoctadecanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnII (NEB), 1X DpnII buffer (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnI (NEB), 1X CutSmart (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... coli 10-Beta (NEB) and BL21(DE3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mM dNTPs (NEB), 10 μM Fwd (5’ GAGGGCCTATTTCCCATGATTC) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We then performed PCR reactions at 12 cycles using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We then performed PCR reactions at 12 cycles using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We did 12 rounds of high-fidelity PCR amplification (Phusion High-Fidelity DNA Polymerase, NEB, Ipswich, MA) using PCR primers that included one of 12 unique Illumina multiplex read indices (Supplementary Table S2) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 ng of DNA was digested with 6 to 12 U of the restriction enzyme PvuII (NEB) overnight at 37°C.
-
bioRxiv - Microbiology 2022Quote: ... as follows: 1µL of 2µM MBTUni-12 primer (5’-ACGCGTGATCAGCRAAAGCAGG-3’) + 1µL 10mM dNTPs Mix (NEB #N0447S) + 8µL Nuclease-free water (Ambion ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 µl of 1 mM BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 µl of axonemes ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 µl of 1 mM BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 µl of axonemes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... containing 12·5 μL of Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs, M0494S), 1·1 μL of 10 μM SARS-Cov2-Midnight-1200 primer (either Pool 1 or Pool 2)(17 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The DNA was PCR amplified for 12 cycles using indexed primers (New England BioLabs, E7335S or E7500S) to barcode samples ...
-
bioRxiv - Microbiology 2024Quote: ... Size-selected cDNA was then PCR amplified for 12 cycles using Q5 High-fidelity polymerase (NEB #M0491S). Amplified libraries were then run on a 6% TBE gel ...
-
bioRxiv - Microbiology 2024Quote: LT area was amplified from 12-week gDNA with PCR using Q5 High-Fidelity DNA Polymerase (NEB) and cloned to pUC19 vector to BamHI/HindIII site ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, N0446), 10 μL 10x T4 DNA Ligase Reaction Buffer (NEB B0202S) ...
-
bioRxiv - Genetics 2020Quote: ... We digested 10 µg of RCP83 using 10 µL SfiI enzyme (NEB, #R0123S) in 50 µL 10x NEB CutSmart buffer and water to 500 µL ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: ... To the RNA was then added 10 μl of 10× Capping Buffer (NEB), 5 μl of 10 mM GTP ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, #N0446), 10 μl 10x T4 DNA Ligase Reaction Buffer (NEB #B0202S) ...
-
bioRxiv - Cell Biology 2021Quote: ... To 10 ul of this sample 10 μl of lambda phosphatase buffer (NEB), 10 μl of 10 mM MnCl2 ...
-
bioRxiv - Genomics 2020Quote: DpnI digest: 10 ug genomic DNA + 10 uL CutSmart Buffer (New England Biolabs) + 2 uL DpnI (New England Biolabs ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 12 μl was used to synthesize cDNA using the Protoscript II First Strand cDNA Synthesis Kit (NEB) with the oligo d(T)23 primer in a total volume of 40 ul ...
-
bioRxiv - Plant Biology 2021Quote: ... transposed DNA was PCR amplified with 12 cycles using Next High-Fidelity 2×PCR Master Mix (NEB, M0541) with Nextera DNA CD Index primers ...
-
bioRxiv - Biochemistry 2020Quote: ... The transcription reaction was carried out at 37°C for 12 hours with T7 polymerase (New England Biolabs) in the presence of 13C/15N labeled nucleotide triphosphates (Cambridge Isotope Laboratories ...
-
bioRxiv - Biophysics 2022Quote: ... 40 μL of pooled oligonucleotides (100 μM) were mixed with 12 μL ddUTPs (1 mM, New England Biolabs), 2.4 μL TdT (20000 U/mL ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by a 12-cycle polymerase chain reaction (PCR) using high-fidelity Phusion DNA Polymerase (New England BioLabs). DNA amplification was confirmed using Qubit fluorometry ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA libraries were amplified using a 12 cycle PCR with NEBNext® Multiplex Oligos for Illumina protocol (NEB) and a standard Phusion polymerase protocol (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR was performed for 12 cycles using NEBnext High-Fidelity 2X PCR Master Mix (New England Biolabs, M0541L) (41) ...
-
bioRxiv - Plant Biology 2021Quote: ... Residual primers and nucleic acids were removed from PCR reactions with Exonuclease I (New England BioLabs) and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... and decapped using Tobacco Acid Pyrophosphatase (TAP) enzyme (Epicentre, can be replaced by RppH from NEB) and purified by phenol/chloroform extraction ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR product was purified using Monarch® Nucleic Acid Purification Kit (New England Biolabs Inc.).
-
bioRxiv - Molecular Biology 2021Quote: ... Customized PURExpress reconstituted systems lacking all amino acids and release factors (Δaa, ΔRF123) (New England Biolabs) (Fig ...
-
bioRxiv - Microbiology 2022Quote: ... aliquots of 200 ng nucleic acid were treated with 2 U DNase I (New England Biolabs), 10 U S1 nuclease (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Genomic deoxyribonucleic acid (gDNA) was extracted using Monarch Genomic DNA Purification Kit (New England BioLabs, T3010S) following procedures for Tissue gDNA isolation ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... The extracted nucleic acids were fragmented using a restriction enzyme cocktail with BsrB I (NEB, R0102S), HindIII (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... in a 10 μl reaction using 10 U T4 RNA ligase (New England Biolabs) in 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Genomics 2023Quote: ... 25 µl of 10×CutSmart Buffer and 10 µl of Hae III (NEB, #R0108L) were added to each tube ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 μL RNAs were mixed thoroughly with 1 μL T4 PNK (10 U, NEB), 1 μL purified TS2126 and 1 μL PAP1 enzyme (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... coli (10-beta, NEB, C3020K) were thawed on ice and mixed with 6 µg of purified 3Cs-DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 U of HaeIII (NEB), and >0.1 pg of genomic template DNA ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli NEB 10-beta (NEB) was used for cloning ...
-
bioRxiv - Genomics 2021Quote: ... 10 μL buffer 3.1 (NEB) and ultrapure water to a final volume of 70 μL ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl DpnII (R0543M, NEB) (500 U per tube ...
-
bioRxiv - Bioengineering 2020Quote: ... 10 units BsaI (NEB #R3733), 10 units PNK (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units BsaI-HFv2 (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 10 μl MboI (NEB R0147S), 5 μl CviQI (NEB R0639S) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mm NTP mix (NEB), Ribolock (Thermo scientific) ...