Labshake search
Citations for New England Biolabs :
401 - 450 of 6234 citations for 8 HYDROXY 1 3 DIOXOLO 4 5 G QUINOLINE 7 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... beads were incubated with 10 µL of USER mix (1 µL of 10X USER buffer and 1 µL of USER enzyme in 8 µL of nuclease-free water, NEB) and incubated at 37°C for 15 minutes ...
-
bioRxiv - Neuroscience 2021Quote: NFIB 3’ UTR and 5’ UTR HP forming regions were in vitro transcribed using T7 transcriptase (NEB, E2040) and purified with Trizol extraction (described in RT-qPCR paragraph) ...
-
bioRxiv - Genomics 2020Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Neuroscience 2019Quote: ... Ten microliters of PCR products were digested with Nsi1 (3 hours with 5 units of Nsi1 enzyme (NEB)) and then ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5µL of 10µM MBTUni-12 primer + 2.5µL of 10µM MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) + 10µL 5x HF Phusion Buffer + 1µL 10mM dNTPs mix (NEB #N0447S) + 0.5µL Phusion Polymerase + 28.5µL of Nuclease-free water (Ambion ...
-
bioRxiv - Microbiology 2019Quote: The DNA oligo i116 that served as a 3’ adapter was adenylated using 5’ DNA Adenylation Kit (NEB), purified by ethanol precipitation as above and diluted to 10 μM with nuclease-free water.
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... and cloned between 300 bp of PCR amplified DNA fragments of the LdBPK_250018100.1 5’ and 3’ UTR using NEBuilder (NEB) inside pUC19 for construct amplification in E ...
-
bioRxiv - Molecular Biology 2021Quote: ... R: 5’-ccgggaaaaactgaaaaaccattggcacgacaggtttcccgac-3’ from the pKAM555 vector) was inserted at the ClaI site using HiFi assembly (NEB). For the intTEL0 strain creation the pUC19LG plasmid (lacking the PstI(blunted)-BclI fragment of the HARS36 sequence ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Genetics 2022Quote: ... The second strand cDNA synthesis was performed using Klenow fragment 3’-5’ exo (New England Biolabs Inc, USA), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 µl of 100 mM dATP solution and 2.5 µl of Klenow Fragment (3′->5′ exo-) (NEB, #M0212L) were added to the mixture ...
-
bioRxiv - Molecular Biology 2023Quote: ... using ETAA1 DBR R1 RT-PCR primer 5′-AAGTTCTTCTTCTTGACTTTGTGTT-3′ and treated with RNaseH (New England Biolabs, M0297S). 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... A single adenine base was added to fragment ends by Klenow fragment (3′ to 5′ exo minus; NEB), followed by ligation of Illumina adaptors (Quick ligase ...
-
bioRxiv - Microbiology 2019Quote: ... Primer sequences were as previously described.7 Samples were digested with 1 unit of BamHI-HF enzyme (NEB) prior to running the PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs-chemicals) solution and the G-banding karyotype was determined ...
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix ...
-
bioRxiv - Plant Biology 2023Quote: ... 7 µg (DNA mass) of NCPs (with 188bp NPS) or free DNA was incubated with 5 Kunitz units of MNase (NEB M0247) in a reaction buffer (30 mM Tris pH 8.0 ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Nuclei were pelleted at 500 × g at 4°C for 5 minutes and resuspended in 0.5 mL of 1.2x NEBuffer r2.1 (New England Biolabs) containing 3% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei were centrifuged (500xg, 5 min, 4°C) and washed once with 1X NEBuffer 2.1 (NEB, #B7202). For nucleosome depletion ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid (5 μL) was used as template for reverse transcription using LunaScript® RT SuperMix Kit (New England Biolabs, Hitchin, UK) in 20 μL reaction volume ...
-
bioRxiv - Microbiology 2020Quote: ... The flies were homogenised in 100 μl of TE-buffer pH 8 containing 1% Triton X-100 and 1% Proteinase K (NEB, P8107S). Homogenates were incubated for 3 h at 55°C followed by a 10 min incubation step at 95°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 8 µl klenow polymerase (NEB M0210L) and 37.5 µl Biotin-14-dATP (Thermo 19524016 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 8 ul 5X HF buffer (NEB), 1 ul 25 uM library 1st round forward primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 μl 50% PEG 8000 (NEB), 1.3 μl T4 RNA ligase (30 U/µl ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 units of RNAse inhibitor (NEB), and 10 µm of malachite-green dye was added to each reaction.
-
bioRxiv - Neuroscience 2023Quote: ... 8 U/mL Proteinase K (NEB)) and incubated overnight at RT ...
-
bioRxiv - Biophysics 2023Quote: ... and 8 μl DpnI (NEB, R0176S) in 400 μl final volume ...
-
bioRxiv - Bioengineering 2024Quote: ... containing 0.06 % pluronic acid (F-127, final concentration) and 1 µL of each disulfide bond enhancer 1 and 2 (NEB #E6820). We used droplet oil consisting of 3M™ Novec™ HFE7500 Engineered Fluid (3M ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Genomics 2022Quote: The crRNAs and tracRNA (see Extended Table 3) were mixed 1:1 to 1 μM in supplied buffer 3.1 (NEB) with 0.2 U/μl RNaseOUT™ (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ end of the first block and the 3’ end of the last block contained SapI (NEB, R0569) recognition sites instead ...
-
bioRxiv - Molecular Biology 2020Quote: ... Selectively captured polyadenylated RNAs (1μg) were ligated directly to an DNA/RNA hybrid adapter (5’-CTACAC GACGCTrCrUrUrCrCrGrArUrCrUrNrNrN-3’) using T4 RNA ligase (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Genomics 2019Quote: ... was hybridized to the 3’ adapter and the 5’ adapter ligated by adding 2μL T4 RNA ligase buffer (NEB), 5μL PEG 8000 (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... The PCR product was inserted into pcDNA3.1 via 5’EcoRI/3’NotI restriction digestion and a standard ligation protocol (T4 DNA Ligase; New England BioLabs) to create pcDNA3.1-Ncadherin ...
-
bioRxiv - Biochemistry 2021Quote: ... Construct included 5’ and 3’ complementary overhangs for ligation into pPICZαA using NEBuilder HiFi DNA Assembly (New England Biolabs) to form pPICZαA_GH43_34 ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were incubated for 5 min on ice and 3 μL of 10X G5 buffer (New England BioLabs, UK) were added to the samples together with 1.5 μL of 25X concentrated protease inhibitor cocktail (Roche ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Genomics 2023Quote: The standard HiDEF-seq v2 protocol was followed with the exception of replacing Klenow fragment 3’→5’ exo-polymerase with one of the following: 9.6 U Bst large fragment (NEB), 9.6 U Bst 2.0 (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the second linker SI183 5’-/Phos/NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAG/ddC/-3’ was preadenylated by Mth RNA Ligase (New England Biolabs) as described previously8 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and was cloned into PCW57.1 at the 5’ BSRGI and 3’ BAMHI restriction sites using NEBuilder HIFI DNA Master Mix (New England BioLabs).
-
bioRxiv - Microbiology 2023Quote: ... the 5’-PPP RNA in the total RNA was specifically capped with 3’-Desthiobiotin-GTP (New England BioLabs, N0761) by the Vaccinia Capping System (New England BioLabs ...
-
bioRxiv - Genomics 2023Quote: ... 5 µg of genomic DNA was dephosphorylated by 3 µL of Quick Calf Intestinal Phosphatase (CIP, New England Biolabs) in a total volume of 30 µL for 10 min at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... This end-repaired DNA was subjected to A-tailing using the Klenow 3′–5′ exo− enzyme (New England Biolabs). The subsequent step involved the ligation of methylated adapters to the A-tailed DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Biochemistry 2023Quote: The library was ligated to the barcode oligonucleotide at a 7:1 oligo:library ratio overnight at 16 °C with T4 DNA ligase (New England Biolabs). A no-insert negative control was also ligated overnight using identical conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...