Labshake search
Citations for New England Biolabs :
551 - 600 of 4511 citations for 8 DECYLOXYPYRENE 1 3 6 TRISULFONIC ACID TRISODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Microbiology 2020Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... followed by 3′ adaptor ligation using T4 ligase (NEB). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µL murine RNase Inhibitors (40 U/µL NEB) and 125 µM NTP-mix (NEB) ...
-
bioRxiv - Biochemistry 2019Quote: ... and 3 protease inhibitor cocktail tablets (New England Biolabs) were added to the cell suspension ...
-
bioRxiv - Biochemistry 2020Quote: ... and 3 μL of CutSmart buffer (New England Biolabs) with 4 μL of sterile water ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3 μl Klenow Fragment (exonuclease-deficient; M0212, NEB). The HDMI-array was incubated at 37 °C for 2 hr in a humidity-controlled chamber.
-
bioRxiv - Microbiology 2020Quote: ... 3’ blocked oligodeoxynucleotide RNA linker (S1315S, New England BioLabs) was ligated to the 3’ ends of RNAs by incubation with RNA ligase 2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... by Klenow fragment (3’→5’ exo-) (NEB, Ipswich, MA) for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Then 3 µl USER® Enzyme (New England BioLabs) was used with size-selected ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 µl of G3 reaction buffer (NEB, MA) and 2 µl PNGase F (NEB P0704S) ...
-
bioRxiv - Microbiology 2020Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... T4 PNK 3’ phosphatase minus (New England BioLabs, M0236S) was used.
-
bioRxiv - Molecular Biology 2019Quote: ... 0.5 ul T4 PNK - 3’ phosphatase minus (NEB M0236L). Samples were then washed 3 times on a magnetic rack with PNK wash buffer ...
-
bioRxiv - Bioengineering 2019Quote: ... after which 3 μL USER enzyme (New England Biolabs) was incubated with size-selected ...
-
Removal of Spo11 from meiotic DNA breaks in vitro but not in vivo by Tyrosyl DNA Phosphodiesterase 2bioRxiv - Molecular Biology 2019Quote: ... 15 units of Klenow (3′→5 ′ exo–) polymerase (NEB) with 66 nM dNTPs for 30 minutes at 30°C ...
-
bioRxiv - Cell Biology 2019Quote: ... using 3-part Gibson assembly reaction (New England Biolabs). αCat cDNAs carrying various mutations (Suppl ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.15 U Klenow Fragment (3’→5’ exo-) (NEB) in 1X NEBuffer 2 at 37°C for 30 minutes (cite) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5μL Klenow Fragment (3′->5′ exo-, NEB, N0202S) for A-tailing were added at 37°C for 40 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... 3 µL DNA polymerase I (50,000 U/ml NEB) and 80 µL deionized H2O ...
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.
-
bioRxiv - Genetics 2020Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Genomics 2021Quote: ... Then 3 μl of USER Enzyme buffer (NEB, USA) was incubated with size-selected ...
-
bioRxiv - Molecular Biology 2022Quote: ... An additional 3 µL of BamHI-HF (NEB R3136L) was added to linearize mtDNA from all cell lines with the exception of human skeletal muscle myoblasts ...
-
bioRxiv - Molecular Biology 2022Quote: ... for which 3 µL of EagI-HF (NEB R3505) was added due to the mitochondrial genome in this cell line having a SNP resulting in a second BamHI cut site ...
-
bioRxiv - Microbiology 2022Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... a custom 3’ adapter (5ʹ-rAppCTGTAGGCACCATCAAT–NH2-3ʹ, NEB) was ligated to all RNAs following the protocol described in (91) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 μl of 50% PEG 8,000 (New England Biolabs), 1 μl of iTP_3’_linker_ApoI (10 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...
-
bioRxiv - Genetics 2023Quote: CAAGCAGAAGACGGCATACGAGAT-3’) and Phusion DNA polymerase (New England Biolabs,
-
bioRxiv - Genomics 2023Quote: ... Each reaction contained 3 uL BbsI (New England Biolabs), 1.25 uL T4 ligase (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... NU-1611-Cy3),1.5ul of Klenow Fragment (3’→5′ exo-, NEB, M0212S) and 1.5ul of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was 3’ dephosphorylated using T4 Polynucleotide Kinase (NEB) and preadenylated linkers were ligated to the RNA fragments using T4 RNA Ligase 2 K277Q (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 µL 5ʹ Deadenylase (New England Biolabs, M0331S) at 37°C for 1 h and further cleaned up by using a Zymo RNA Clean and Concentrator-5 purification kit (Zymo Research ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 U BglII (New England Biolabs, Cat. No. R0144S) and 6 U SalI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.5ul of Klenow Fragment (3’→5′ exo-, NEB, M0212S) and 1.5ul of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Bioengineering 2022Quote: ... and single amino acids were made by KLD site directed mutagenesis (New England Biolabs). Rotavirus antigens were designed based on optimized sequences described previously ...
-
bioRxiv - Molecular Biology 2020Quote: ... The nucleic acids were subsequently radiolabeled with γ32P-ATP using T4 polynucleotide kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Gel fragments of homozygous clones were extracted using Monarch Nucleic Acid Purification Kits (NEB) and submitted for Sanger Sequencing ...
-
bioRxiv - Immunology 2020Quote: ... and gel fragments of clones were extracted using Monarch Nucleic Acid Purification Kits (NEB) and submitted for Sanger Sequencing ...