Labshake search
Citations for New England Biolabs :
1 - 50 of 1784 citations for 8 CHLOROQUINOLIN 2 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... (2) +28 μl Dam at 8 U/μl (NEB M0222L); (3 ...
-
bioRxiv - Biophysics 2023Quote: ... Amine-modified DNA oligonucleotides (NH2/GTGATGTAGGTGGTAGAGGAA) were linked to the benzylguanine (BG; NEB), and BG-oligonuculeotides were labeled with myosin II containing a C-terminal SNAP-tag (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... 2 μM X4L4 or 8 U/μL T4 DNA ligase (New England BioLabs) and an increasing amount of PEG 8k (w/v ...
-
bioRxiv - Biochemistry 2020Quote: ... 8 μL of the de-phosphorylated DNA was incubated with 2 μL T4 Polynucleotide Kinase (NEB M0203S), 3 μL γ32P-dATP (Perkin Elmer) ...
-
bioRxiv - Genomics 2023Quote: ... Each reverse transcription reaction contained 8 μL template RNA and 2 μL LunaScript RT SuperMix (NEB #E3010). The reaction condition for reverse transcription was ...
-
bioRxiv - Immunology 2022Quote: ... Final amplification PCR was performed as described before by adding 8 µl of 2 x PCR MM (NEB) with number of cycles according to qPCR (usually Cq values were around 20) ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids coding for segments 2 and 8 were digested using BbsI restriction enzyme (New England Biolab, NEB), the plasmid coding for segment 10 was linearized with BsaI (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... The alkyne-PAR was purified to remove excess alkyne-PEG1-amine using the Monarch Nucleic Acid Cleanup Kit (NEB) following the recommended protocol ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was buffer exchanged into enterokinase cleavage buffer (20 mM Tris pH 8, 50 mM NaCl, 2 mM CaCl2) and cleaved using bovine enterokinase (EK, NEB) at 16U/mg protein for 4 hrs ...
-
bioRxiv - Molecular Biology 2021Quote: ... after incubating the samples with 2 μl of RNase A (Thermo) at 37 °C for 2h and then with 8 μl of proteinase K (NEB) at 55 °C for 4h ...
-
bioRxiv - Immunology 2022Quote: ... 2018” tagmentation mix were either sorted into plates containing RCB buffer for condition “hiSDSprotK-TWEEN” (2 x RCB: 100 mM Tris-HCl pH 8, 100 mM NaCl, 40 µg/mL Proteinase K (NEB), 0.4 % SDS (Sigma ...
-
bioRxiv - Genomics 2021Quote: ... The PCR mix (8 µl H2O, 2 µl primer mix P5Solexa/P3Solexa, 10 µM each, 20 µl Phusion HF Mix [New England Biolabs]) was added to 10 µl cDNA ...
-
bioRxiv - Genomics 2021Quote: ... Fragmentation was carried out by adding 50 μL NEB Buffer 2 and 8 μL of 25 U/μL MboI restriction enzyme (New England Biolabs). Samples were incubated at 37 °C for 2 hours with rotation ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 8 mM rNTPs (NEB #N0466S), 250 U T7 RNA Polymerase (NEB #M0251L ...
-
bioRxiv - Biophysics 2023Quote: ... 8 μl XhoI (NEB, R0146S) and 8 μl DpnI (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were split into two separate reaction tubes containing 8 μL of PCR product + 1 μL 10X NEB® Buffer #2 (New England Biolabs®). These were incubated in a thermocycler with an initial denaturation of 95 °C for 5 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... 8 µl klenow polymerase (NEB M0210L) and 37.5 µl Biotin-14-dATP (Thermo 19524016 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 8 ul 5X HF buffer (NEB), 1 ul 25 uM library 1st round forward primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 μl 50% PEG 8000 (NEB), 1.3 μl T4 RNA ligase (30 U/µl ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 units of RNAse inhibitor (NEB), and 10 µm of malachite-green dye was added to each reaction.
-
bioRxiv - Neuroscience 2023Quote: ... 8 U/mL Proteinase K (NEB)) and incubated overnight at RT ...
-
bioRxiv - Biophysics 2023Quote: ... and 8 μl DpnI (NEB, R0176S) in 400 μl final volume ...
-
bioRxiv - Genomics 2020Quote: ... 8 units of SbfI and 8 units of HF-MseI (New England Biolabs, Frankfurt am Main, Germany). Digestion was performed at 37°C for 2 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... 8 μL 5x first-strand buffer (NEB), 2 μL 10 mM dNTPs (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 8 μl DpnII (400 U, NEB, R0543M) was added to each and samples were incubated at 37°C overnight with rotation.
-
bioRxiv - Bioengineering 2019Quote: ... 8 U/µl Taq DNA ligase (NEB), 2 mM β-Nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 μl NEB RNase If (NEB M0243S) per OD260 of ~10 was added in 2ml of lysis buffer ...
-
bioRxiv - Biophysics 2020Quote: ... and loading dye (8 μL, B0363S, NEB) and loaded denatured (70 °C ...
-
bioRxiv - Physiology 2019Quote: ... and 8 μl of PNGase F (NEB) were added ...
-
bioRxiv - Immunology 2020Quote: ... or 8 μM bortezomib (BTZ; LC Biolabs). Mock treatment consisted of an equivalent volume of the matching solvent ...
-
bioRxiv - Molecular Biology 2022Quote: ... 8 U murine RNase inhibitor (NEB # M0314), 0-1 μM recombinant protein ...
-
bioRxiv - Biochemistry 2023Quote: ... 8 U murine RNase inhibitor (NEB # M0314L), and 0-3.4 μM recombinant protein ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8 injected embryos and 8 control uninjected siblings were assayed by PCR amplification and T7 endonuclease (New England Biolabs, M0302S) digest for mutation analysis41 ...
-
bioRxiv - Genomics 2020Quote: ... 0.2% SDS) with 8 μL Proteinase K (NEB) at 65°C for 1 hour ...
-
bioRxiv - Genetics 2020Quote: ... 8 µL of T4 DNA ligase (NEB #M0202M), and water to 800 µL ...
-
bioRxiv - Cell Biology 2021Quote: ... and 8 μl of phosphatase reaction buffer (NEB). After incubation at 30°C for 30 minutes ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... 8 U/ml DNaseI (RNase-free, NEB, M0303L) were added to each sample ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Cell Biology 2023Quote: ... 8 U/ml proteinase K (New England Biolabs) diluted in digestion buffer (containing 50 mM Tris pH 8.0 (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... along with 8 units of RNAse inhibitor (NEB), and 10 µm malachite green oxalate added to each reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... using 8 units of T4 RNA ligase 1 (NEB) and 8 nmol of ATP in a final volume of 8 μl for 1 h at 37°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... 8 μL of BSA (20 mg/mL B9000S, NEB,) and 100 Units of ligase (M0202M ...
-
bioRxiv - Genomics 2022Quote: ... and 8 units/μL T7 RNA Polymerase (NEB, M0251S) in the transcription buffer (40 mM Tris-HCl pH 8 ...
-
bioRxiv - Pathology 2021Quote: ... 8 neuraminidases (both New England BioLabs, Ipswich, MA, US) separately or in combination according to the manufacture’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 8 µM BC-647 (CLIP-Surface 647, NEB) in a base solution of Passive Lysis Buffer was rotated overnight at 4°C to label CLIP-tagged proteins ...