Labshake search
Citations for New England Biolabs :
101 - 150 of 3672 citations for 8 8 dimethylpyrano 2 3 h chromen 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 8 μL of 5X Quick Ligation Reaction buffer (NEB: B6058S), 6 μL of the RMX adapter and 3 μL of T4 DNA ligase (2,000,000 units/mL).
-
bioRxiv - Neuroscience 2020Quote: ... and incubated with 8 μl of T4 Polynucleotide Kinase (NEB) and 2 μl of 10 mM ATP for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: 8 different polymerases (KAPA HiFi HotStart, Qiagen Taq, Q5 (NEB), Phusion Hot Start Flex DNA Polymerase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 8 units of Bst 2.0 warmstart DNA polymerase (NEB) followed by incubation at 60°C for 2 minutes to extend the strand with EdUTP-containing DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... was mixed with 8 mM m7G cap analog (ARCA; NEB), TMG cap analog (Jena Bioscience ...
-
bioRxiv - Biophysics 2023Quote: ... 8 mM ATP and 10 units of T4 ligase (NEB) were incubated overnight at 16°C ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 and 3 were assembled by PCR assembly using Vent polymerase (NEB), with each reaction consisting of 1 x ThermoPol buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... α1- 3,4,6), 10 U β-galactosidase (P0726S, β1-3) and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs, USA). All reactions were performed in a final volume of 10 μl in 50 mM sodium acetate buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μL GlycoBuffer 2 10X (NEB), 2 μL NP-40 ...
-
bioRxiv - Biochemistry 2022Quote: ... Mif2 was treated for 2 h at 30 °C with lambda-phosphatase (New England Biolabs) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 1 h followed by incubating with 2 μL Proteinase K (New England Biolabs, USA) at 65 °C ...
-
bioRxiv - Genomics 2020Quote: ... 30 μL H2O) and 8 μL Large Klenow Fragment (NEB, M0210L) and 2 μL T4 PNK (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... and then passed over an 5-8 mL amylose column (NEB). The bound protein was washed with ten CV of Amylose Wash Buffer (50 mM Tris pH 7.5 ...
-
bioRxiv - Genetics 2020Quote: ... 8 μl of DNA polymerase I Klenow (NEB M0210, 5U/μl), and 4 μl of T4 DNA polymerase (NEB M0203 ...
-
bioRxiv - Microbiology 2020Quote: ... and diluted in 8 ml ligation buffer (1X ligation buffer NEB without ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the addition of 8 U murine RNase inhibitor (NEB # M0314L) (Kearse et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 8 µl RNase III (1:1000 diluted, New England Biolabs) or RNase If (1:100 diluted ...
-
bioRxiv - Bioengineering 2024Quote: ... pH 8.0) containing 8 units mL−1 proteinase K (NEB, P8107S) at 37 °C for 4 h ...
-
bioRxiv - Genetics 2024Quote: ... 1 µg of plasmid was incubated with 8 U M.SssI (NEB) at 37°C for 4 h for in vitro DNA methylation ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H4 (Lys 8) rabbit pAb (PTM Biolabs, SKU: PTM 311), Butyryl-Histone H4 (Lys 5 ...
-
bioRxiv - Genetics 2019Quote: ... Flag-Mad-8 was generated by PCR followed by Gibson assembly (NEB) and the S359L substitution was verified by sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... the isolated glycoproteins are treated by α-2,3/6/8 neuraminidase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 M NaCl and 8 units/ml Proteinase K (New England Biolabs) in 1x PBS] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... using 1/8 reaction of NEBNext dsDNA Fragmentase (#M0348, New England Biolabs) incubated at 37°C for 5 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Biophysics 2019Quote: ... for one h at 37 °C in the CutSmart™ buffer (NEB). After that ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...