Labshake search
Citations for New England Biolabs :
51 - 100 of 2799 citations for 7H Pyrrolo 2 3 b pyridine 3 7 dimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... 3 μL exonuclease buffer (NEB) and 4 μL nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL XmaI (NEB R0180S) was added to fragment chromatin ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl HinP1I (NEB R0124S), 3 μl DdeI (NEB R0175L) ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl CviAII (NEB R0640L), 3 μl FspBI (ThermoFisher ER1762) ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl DdeI (NEB R0175L), 3 μl CviAII (NEB R0640L) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL Rnl2KQ (NEB M0373S), water to 30 µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μl USER Enzyme (NEB) was then incubated with size-selected ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index Primers Set 3 (NEB). Amplified libraries were cleaned up using Sample Purification Beads (NEB ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Genomics 2020Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by addition of 3’-A overhangs using Klenow Fragment 3’-5’ exo- (NEB, M0212S). After denaturation of DNA at 95°C for 3 min ...
-
bioRxiv - Cell Biology 2021Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Genomics 2020Quote: ... and once the solution is clear 48 uL of the elution was transferred to a 2mL Lo-Bind tube with End-Repair and A-tail buffer (7 uL) and enzymes (3 uL) premixed (NEBNext® Ultra™ II kit, New England Biolabs). The solution was then mixed by gentle tapping and transferred to a 0.2 mL PCR tube and incubated at 20 degrees C for 30 minutes and 65 degrees C for 30 minutes in a thermocycler ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Genomics 2019Quote: ... was ligated to the 3’-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242L) in presence of PEG 8000 (2.5% w/v) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3’ end filling and dA tailing was performed by Klenow Fragment (3’>5’ exonuclease deficient; NEB). Libraries were prepared by ligation of NEBNext adapters and indexed i7 primers (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Molecular Biology 2021Quote: ... 3 ml of Thermolabile ExoI (BioLabs) was added to each reaction and samples were incubated for 15 min at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... 3 µL Klenow exo (NEB M0212S)] to the 32 µL of DNA sample from the previous step ...
-
bioRxiv - Genomics 2019Quote: ... 3 U Klenow exo (NEB M0212S)] to the 32 µL of DNA sample from the previous step ...
-
bioRxiv - Genomics 2019Quote: ... 3 U Klenow exo (NEB M0212S)] to the 32 µL of DNA sample from the previous step ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Molecular Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’ overhangs removed with Klenow (NEB) to form blunt ends ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µl T4 DNA ligases (NEB), and 2 µl of a 15 µM Illumina indexed adapter at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL 10xDNase I Buffer (NEB), and 24 μL WB2 ...
-
bioRxiv - Plant Biology 2022Quote: ... and 3 (NEB, catalog No. E7500S) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 μl QuickCIP enzyme (NEB) at 37°C for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Neuroscience 2023Quote: ... Then 3 μL USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... 3 µL 10x reaction buffer (NEB), 0.25 µl 1 M MgCl2 and 0.3 µl Rnasin ribonuclease inhibitor (Promega ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 μL USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µL RNase A (NEB) in volumes normalized to OD600 of culture samples ...
-
bioRxiv - Genomics 2019Quote: ... Glucosylated DNA was then end repaired without purification followed by ligation to Pyrrolo-dC adaptors as indicated in NEBNext Ultra II DNA library preparation protocol (NEB, Ipswich, MA, USA) with the following modification to the protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... the 3’ adapter was first ligated using 0.5 μl of 3’SR Adapter for Illumina (NEB-kit) added to 30 ng of input RNA diluted in 3.0 μl nuclease free H2O ...
-
bioRxiv - Plant Biology 2021Quote: ... The antisense strand with a 3′ phosphate was radiolabeled by T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB) and [γ-32P]ATP ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Microbiology 2022Quote: ... 23 nt RNA (5’-GAAUCUAUACAUAAAGACCAGGC-3’) was capped with vaccinia capping enzyme and 2’-O-methyltransferase (NEB) and radiolabelled with [α 32P]-GTP ...
-
bioRxiv - Microbiology 2019Quote: 2–3 μL of recovered DNA was electroporated into NEB® 10-beta Electrocompetent cells (C320K, NEB) and plated on chloramphenicol LB plates ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Molecular Biology 2022Quote: 3’ linker ligation (1x PNK buffer, 800 U T4 RNA ligase 2 truncated KQ (NEB, Cat#M0373L), 80 U RNaseOUT ...