Labshake search
Citations for New England Biolabs :
451 - 500 of 1780 citations for 7 chlorobenzo b thiophen 3 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2022Quote: ... qRT-PCR analysis was carried out using the Luna Universal One-Step RT-qPCR kit (NEB) using 100 ng RNA as input according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2021Quote: ... A-overhangs were added to Phusion products with one unit Taq polymerase (New England Biolabs; MO267S) followed by 10 min incubation at 72°C ...
-
bioRxiv - Genomics 2019Quote: ... samples were cooled and then digested with DpnII for one hour at 37°C (NEB, R0543). These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′ -GGTCGCGGCCGAGGATC-3′ ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR Kit (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... One microgram (1ug) of PCR was digested with 1ul of EcoR I-HF (New England Biolabs) and 1ul Hind III-HF (New England Biolabs ...
-
bioRxiv - Immunology 2021Quote: ... the uridines present in one cDNA strand were digested with uracil- N-glycosylase (New England BioLabs), as described 67 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression was determined using SYBR green Luna One Step RT-qPCR Kit (New England BioLabs) on a C1000 Touch (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: One μg of RNA was reverse transcribed using the LunaScript RT SuperMix Kit (New England Biolabs) according to the manual ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the modifications (gRNA and complementary sequences) were introduced in one step using Q5 mutagenesis (NEB) and was placed in the MoClo pICH86988 acceptor with a 35S promoter ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was reverse-transcribed and PCR amplified using Luna Universal One-Step RT-PCR Kit (NEB). SARS-CoV-2 replication was assessed by using primers specific to the N mRNA (Forward 5’-CTCTTGTAGATCTGTTCTCTAAACGAAC-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... One round of m6A immunoprecipitation was performed using the EpiMark N6-Methyladenosine Enrichment Kit (NEB #E1610S) and protocol ...
-
bioRxiv - Immunology 2023Quote: Reverse transcriptase qPCR was performed using Luna Universal Probe One-Step RT-qPCR Kit (NEB, # E3006L). The following predesigned primers and probe sets for each target and the housekeeping gene GAPDH were purchased from IDT:
-
bioRxiv - Biochemistry 2023Quote: ... RT-PCR reactions were performed using the OneTaq One-Step RT-PCR Kit (New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was performed with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to manufacturer’s instruction on an iQ5 Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were prepared using a Luna Universal One-Step RT-qPCR Kit (New England Biolabs). Quantitative RT-PCR was performed with an Mx3000P qPCR system (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR was performed by using Luna Universal One-Step RT-qPCR reagents (New England Biolabs), following the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: The all-in-one constructs (e.g., pRDA_917) were digested with BsmBI-v2 (New England Biolabs #R0739S) for two hours at 55°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The four TALEN expression vectors encoding one of four possible RVDs were linearised with BsmBI (NEB). The biotinylated α unit fragments were ligated to the first βγδε fragments using Quick T4 DNA ligase and bound to Dynabeads MyOne C1 streptavidin-coated magnetic beads (Life Technologies) ...
-
bioRxiv - Developmental Biology 2024Quote: ... after which the library amplification was one with Phusion High-Fidelity DNA Polymerase (New England Biolabs) during which the Illumina adapters were introduced ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was then performed using Luna Universal One-step RT-qPCR kit (New England Biolabs) following the provided protocol on a BioRad CFX Opus 96 quantitative Real-Time PCR machine ...
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-GTAGTACCATGCCGAAAGCAC-3’, Reverse: 5’-GGAACCACCTATCTGTTATCC-3’, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5’-TGGCGCTAGTATTTGAAGCA-3’, Reverse: 5’-ACTTGGGATCCAATTCTGTCTACT-3’, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
bioRxiv - Microbiology 2019Quote: ... Zip codes were amplified from 100 ng of genomic DNA using primers flanking the zip code region (primers: 5‘-NNACGAAGACAAGATATCCTTGATC-3’ and 5’-NNTGTGTGGTAGATCCACATCG-3’) using Phusion® High-Fidelity DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Cell Biology 2019Quote: A PCR amplified genomic DNA fragment using forward primer 5’-CGATCCTCTTGCCTCCATGT-3’ and reverse primer 5’-CCAGCTGTTCGCGTTCATA-3’ was digested with XmnI (NEB; R0194L). Undigested and digested samples were proceeded for electrophoresis using 2% agarose gels.
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Genetics 2020Quote: ... 5’-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCACTGT-3’ (8bp Barcode) and P5 overhang: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ using Q5 Hot Start High-Fidelity polymerase (NEB, #M0494S) for 21-24 cycles ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Microbiology 2021Quote: ... E1E2 sequence was amplified via PCR from pcDNA E1E2 vector using primers (forward 5’ CGAAGCTTGCATGGGTTGCTCTTTC 3’. and reverse 5’ CAGAATTCCCGCCTCCGC 3’) the product was subsequently digested with HindIII and EcoRI (NEB, USA) and ligated into pEGFP-N1 to create a E1E2-EGFP fusion construct with EGFP at the C-terminal end.
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Genetics 2022Quote: ... locus using the primers ubb polyA fw: 5’-TAGAACCGACAGTCTTAGGGATGG-3’ and ubb polyA rv: 5’-GAATTCATTGCCATCAAGTGTTAGC-3’ with Phusion High Fidelity DNA Polymerase (NEB M0530S), subcloned into the Zero Blunt TOPO PCR Cloning vector (Invitrogen K283020) ...
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and about 200 ng of DNA was digested with the type II b enzyme BcgI (New England Biolabs). This enzyme cuts both upstream and downstream of the 6 bp recognition site ...
-
bioRxiv - Microbiology 2020Quote: ... The pSAG1:U6-Cas9:sgRNA-TgIF2K-B vector was generated using Q5 site-directed mutagenesis (New England Biolabs) (26 ...
-
bioRxiv - Microbiology 2023Quote: Five POWV-LI9 fragments were amplified from viral cDNA (Figure 1A,B) using high-fidelity Phusion polymerase (NEB) and corresponding paired primers (Table S2 ...
-
bioRxiv - Genomics 2023Quote: ... nuclei were isolated from fixed B cells and subjected to in situ digestion using 200U MboI (NEB, R0147M) for 4 hours at 37 ºC ...
-
bioRxiv - Genetics 2023Quote: ... 1.2 M sorbitol) and resuspended in digestion buffer (Buffer B, 200 mM Vanadyl ribonucleoside complex [VRC from NEB] ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.