Labshake search
Citations for New England Biolabs :
501 - 550 of 6329 citations for 7 Oxabicyclo 4.1.0 heptane 2 carboxylicacid 6 ethyl 1 methyl 5 oxo ethylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Genomics 2022Quote: ... and followed by a 5′ decapping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S). The 5′ end was phosphorylated using T4 polynucleotide kinase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... and the m7G(5’)ppp(5’)G RNA Cap Structure Analog (#S1411, NEB) kits ...
-
bioRxiv - Microbiology 2022Quote: ... with the addition of an m7G(5⍰)ppp(5⍰])G RNA cap (NEB). Transcription was carried out at 42°C for 2 hours (h ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of nuclease-free water and 5 µL of GA mastermix (NEB) were added and incubated at 40°C for a minimum of 1.5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 mM G(5’)ppp(5’)G RNA Cap Analogue (New England Biolabs), 4 μg DNA ...
-
bioRxiv - Immunology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). The Hifi assembly products were Ampure bead purified and eluted into 20 µL of H2O ...
-
bioRxiv - Microbiology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour HiFi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). HiFi assembly products were Ampure bead purified and eluted into 20uL of H2O for higher electroporation efficiency.
-
bioRxiv - Neuroscience 2021Quote: ... 2 (NEB #E7500) and 3 (NEB #E7710 ...
-
bioRxiv - Genomics 2021Quote: ... the purified products are treated with Klenow fragment (3’ → 5’ exo-) (Cat. No. M0212L; NEB; use 1 uL) and Taq DNA polymerase (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... the cap-1 structure was added to the 5’ end using the Vaccinia capping enzyme (New England Biolabs) and Vaccinia 2’-O-methyltransferase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: 3’-PUA-DNA was generated by incubation of 1 μM 5’-FAM-labeled AP-DNA (FAM_U_35) with 20 U EndoIII/Nth (NEB) in Buffer B pH 7.0 at 37 °C for 60 m ...
-
bioRxiv - Cancer Biology 2019Quote: ... and then resuspended in sorting buffer (PBS with 0.5% BSA, 2.5 mM MgCl2, 0.5 mM CaCl2, 1 µg/mL DAPI and 100 U/mL DNaseI, NEB) and incubated for 30 minutes at room temperature before sorting ...
-
bioRxiv - Biophysics 2021Quote: ... The phosphorylated 5’-ends were subjected to RNA ligation by 20 units of T4 RNA ligase 1 (NEB) in the presence of 10 mM DNA/RNA rP5_RND oligo (Supplemental Table 3 ...
-
bioRxiv - Molecular Biology 2023Quote: 9N_VRA3 adapter oligonucleotide (Supplementary Table 1) was pre-adenylated with the 5’ DNA Adenylation Kit (New England Biolabs) according to the manufacturer’s protocol at a 5X scale ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA probes (Extended Table 1) at 500 nM were 5’-[32P]-labeled using T4 Polynucleotide Kinase (NEB) and hybridized to the membrane overnight at 37°C in PerfectHyb™ Plus Hybridization Buffer (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: In vitro transcribed CHIKV RNA (nt’s 1-337) was 5’ dephosphorylated using Quick CIP according to the manufacturer’s instructions (NEB) before purification using an RNA Clean & Concentrator column (Zymo Research) ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by on-bead 5’ ligation of a biotinylated REL5 linker sequence using T4 RNA ligase 1 (NEB) for 3 h at 37⁰C ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μl of 10 mM MnCl2 and 1 μl (400 units) of λPP (New England Biolabs, Ipswich, MA). Untreated lysates received 1 μl of H2O in place of λPP ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of 5’ adaptor required (i) Removal of the 5’ cap using RNA 5’ pyrophosphohydrolase (RppH, New England Biolabs, Ipswich, MA, M0356S) (ii ...
-
bioRxiv - Developmental Biology 2021Quote: ... and elongation for 7 min at 72°C) using the Phusion High-Fidelity DNA Polymerase (NEB, #M0530S) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and elongation for 7 min at 72°C) using the Phusion High-Fidelity DNA Polymerase (NEB, #M0530S) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of N protein was dissolved in 36 μL H218O and 2 μL 10x glycobuffer (NEB). To this solution 2 μL PNGase F was added and the reaction mixture was incubated at 37 °C for 16 h ...
-
bioRxiv - Genomics 2021Quote: ... and NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 and 2 (NEB #E7335S, #E7500S), following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... All enzymatic reactions were performed as a 1-step reaction with 1x Glycobuffer 2 (New England Biolabs), 10 μg RBD produced in CHO-S- ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were multiplexed with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2) (NEB). Size selection steps were performed with Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... with NEBNext Multiplex Oligos for Illumina (Dual Index Primers Sets 1 and 2) (NEB #E7600S and #E7780S), with two-sided size selection around a mode of 480 base pairs ...
-
bioRxiv - Systems Biology 2019Quote: ... vaccinia mRNA 2’-O-methyltransferase (NEB, 250 U every 2 h) and water ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2′ O-methylated using Vaccinia VP39 (2′ O Methyltransferase) (NEB) in a reaction that also included 1X capping buffer (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... in the presence of m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB). 5 μg DENV-Luc RNA was electroporated into 2×106 Vero cells ...
-
bioRxiv - Genetics 2022Quote: ... The m7G(5’)ppp(5’)G RNA Cap (New England BioLabs, catalog number S1404L) was used as Cap Analog with 4:1 of Cap Analog:GTP ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl Klenow Fragment (3’->5’ exo-) (NEB, cat#M0212S, 5 U/μl) per amplicon pool reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ ends were dephosphorylated using 5 U of Antarctic phosphatase (New England BioLabs/M0289S). A mix containing the RNA sample (~10 pmol) ...
-
bioRxiv - Genomics 2024Quote: ... the 5’ end of RNAs were enzymatically modified with RNA 5’ Pyrophosphohydrolase (RppH; NEB) and hydroxyl repair was performed using T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The primer sets used were designed by Primer 6 (PREMIER Biosoft Biolabs) (Appendix Table S2) ...
-
bioRxiv - Biochemistry 2019Quote: ... unlabeled AdoMet was left out and 6 μg of MBP2* protein (NEB) was added to each reaction to increase molecular crowding.
-
bioRxiv - Microbiology 2022Quote: ... the reactions were stopped by adding 2µl of 6× loading dye (NEB) containing 20 mM EDTA and analyzed via agarose gel electrophoresis.
-
bioRxiv - Evolutionary Biology 2020Quote: ... SgRNAs were complexed to 6 μg EnGen Spy Cas9-NLS (NEB #M0646) in an approximately 1:1 molar ratio for 15 min at RT ...
-
bioRxiv - Genetics 2021Quote: ... The extract was bound to 6 ml amylose resin (New England Biolabs) for 1 h batchwise ...
-
bioRxiv - Microbiology 2023Quote: ... the isolated glycoproteins are treated by α-2,3/6/8 neuraminidase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and TruSeq 6-bp index adaptor ligation by Quick ligase (NEB M2200S), and NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL T4 PNK (NEB), and 1 µL Klenow large fragment (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL CutSmart buffer (NEB), and 30 μL of nuclease-free water and incubated for 1 h at 37 °C and 10 min at 80 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL HinFI enzyme (NEB), 5 μL ExoI buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL ExoI buffer (NEB), 5 μL CutSmart buffer (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... and SacII (NEB, Figure 5) overnight at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... and 5-mdCTP (NEB #N0365S)) similar to T-WGBS (Lu et al ...