Labshake search
Citations for New England Biolabs :
401 - 450 of 6331 citations for 7 Oxabicyclo 2.2.1 hept 2 ene 5 6 6 trifluoro 1 methyl 1R 4S 5S rel 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... RHA PCR products were ligated into pAAV p21 vector by Gibson assembly at a ratio vector:inserts of 1:2:2 using T4 DNA ligase (NEB). All constructs were checked by sequencing before transfection into cells ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 μL of 2-Log DNA Ladder (200 μg/mL; NEB) is mixed with 1 μL of Gel Loading Dye (6x ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 1 mg/ml bovine serum albumin solution (NEB), 1 μL of hOGG1 (ProSpec TechnoGene Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... 1–2 mg of RNA was treated with DNAse I (NEB), x µL and 2 µL of this reaction was used to make cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ul of micrococcal nuclease (Biolabs M02475, 2×106 U/ml) was added to 200 μl buffer containing 1 mM CaCl2 and incubated for 10 min 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... 1× LongAmp® Taq 2× Master Mix (New England Biolabs, UK), and 2 μL of a unique barcode ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml Tris buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using 5 units of MseI enzyme per 1 μg of DNA and 5 μl of 1X SmartCut™ Buffer (New England Biolabs®). This was followed by the incubation for 45 min at 37°C and inactivation for 20 min at 65° C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unmethylated cytosines were then deaminated to uracil and indexed libraries were prepared using the NEBNext Enzymatic Methyl-seq Kit (NEB #E7120) before being pooled and then sequenced by Illumina paired-end (2×150bp ...
-
bioRxiv - Molecular Biology 2022Quote: The library for EM-seq was prepared using 200 ng DNA input and the NEBNext Enzymatic Methyl-seq Kit (NEB, E7120S) following the manufacturer’s instructions for a standard insert (370-420 bp) ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries for genome wide DNA methylation profiles were generated from 200 ng of genomic DNA using NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs). These libraries were sequenced on an Illumina NextSeq 2000 to generate 100 bp paired end reads.
-
bioRxiv - Bioengineering 2023Quote: ... The APOBEC3A and BSA materials used were purchased from the NEBNext© Enzymatic Methyl-seq Conversion Module kit from New England Biolabs (NEB). The reaction volume was then scaled down to 15.5 uL and modified from the original deamination protocol from the kit ...
-
bioRxiv - Cancer Biology 2024Quote: EM-seq libraries were prepared from genomic DNA as previously (78) using the NEB Enzymatic Methyl-seq kit (New England BioLabs; P7120L). In brief ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 µl 100× Protease inhibitor cocktail and 1 µl of CviKI-1 (5 U/100,000 nuclei, NEB R0710S) were added ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM MgCl2) and either 25 nM NudE.1 WT or NudE.1 E64,65Q or NudC WT (NEB). For NAD spike-in kinetics ...
-
bioRxiv - Microbiology 2020Quote: ... including equimolar amounts of dGTP and 7-deaza-GTP (New England Biolabs), at a concentration of 200 µM was used (Maertzdorf et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... rk430-mScarlet-SNAP (7 μM monomer) was incubated with benzylguanine-biotin (NEB) in a 4 to 1 molar ratio at room temperature for 15 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μg pNZdmsC3GH plasmid was digested with 40 U of SfiI (NEB), separated on a 1% agarose gel and ...
-
bioRxiv - Microbiology 2022Quote: ... for 7-12 h at 37°C in CutSmart buffer (NEB, B7204S). Digested products were then visualised on a 4% NuSieve (Lonza ...
-
bioRxiv - Molecular Biology 2021Quote: ... which was treated with 5 units of T7 endonuclease 1 (New England Biolabs) for 20 min at 37 °C and analyzed by 2% agarose gel electrophoresis ...
-
bioRxiv - Genetics 2019Quote: ... and then treated with 5 units of T7 endonuclease 1 (New England Biolabs) for 30 min at 37°C and finally analyzed by 2% agarose gel electrophoresis.
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA 5’ adaptor was ligated using T4 RNA Ligase 1 - high concentration (NEB) and 10 mM ATP ...
-
bioRxiv - Neuroscience 2024Quote: ... the construct was diluted 1:5 with empty pUC19 vector (New England Biolabs) and then transfected with 7.5 µL of TransIT-293 and 2.5 µg of DNA ...
-
bioRxiv - Microbiology 2020Quote: ... Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB), and the mixture was incubated at 50°C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gluc200 and Gluc200A44 templates were generated using PCR amplification of GLuc of the first 200 nt at the 5’end of pCMV-GLuc 2 Control Plasmid (NEB: https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl of the assembled mix (∼5 ng of vector backbone) was transformed into competent cells (NEB, cat# C2987H), followed by spreading on antibiotic-selective LB agar plates ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of DNA was digested with 50 units of DpnII and 5 μL NEBuffer™ DpnII (NEB, cat #R0543L), in a total volume of 50 μL ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 mM each of forward and reverse primers (Supplemental Table 2) and 0.5 U Phusion® HF DNA polymerase (NEB) in a reaction volume of 25 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...