Labshake search
Citations for New England Biolabs :
151 - 200 of 5659 citations for 7 Oxa 1 2 diazaspiro 4.4 non 1 en 6 one 4 methyl cis 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... PCR round 1 and 2 were performed using Q5-High Fidelity polymerase (NEB) for 6 (FS231 and FS232 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 ul RNaseOUT and 1ul T4 RNA ligase 2 truncated K227Q (NEB M0351). Samples were then washed twice with PNK buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 2□ μl of 1× NEB Next Cell Lysis Buffer (New England Biolabs). FACS sorting was performed with a BD Influx sorter (BD Biosciences ...
-
bioRxiv - Cancer Biology 2022Quote: ... and NEBNext Multiplex Oligos for Illumina (NEB, Set 1 #E7335S, Set 2 #E7500S). ChIP libraries were done following NEB’s guidelines (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μl T4 RNA ligase 2 (truncated K227Q, NEB, 200,000 units/ml) and incubated at 16°C for 14 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 μl were combined with 1 μl 10X T4 Ligation Buffer (NEB, M0202), 6.5 μl Nuclease-free H2O and 0.5 μl T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of 10x T4 RNA ligase 2 (truncated) buffer (New England Biolabs), 3 μl of 50% PEG 8,000 (New England Biolabs) ...
-
bioRxiv - Biochemistry 2023Quote: ... Oligo 1 and oligo 2 were annealed by T4 polynucleotide kinase (NEB, #M0201S) at 37 ℃ for 30 min and 95 ℃ for 5 min ...
-
bioRxiv - Genetics 2023Quote: ... PCR-1 and PCR-2 amplicons were digested with DpnI (NEB Cat#R0176S) for 2 hours at 37°C to remove the YCp50-WT_PKR template ...
-
bioRxiv - Bioengineering 2021Quote: ... qRT-PCR was performed with primers specific for target genes (see Supplementary Table 1 for the list of primers) using the Luna universal One-Step RT-qPCR kit (NEB; E3005). Experiment was performed using the QuantStudio3 (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was diluted 1:50 for RT-qPCR which was conducted using the Luna Universal One-Step RT-qPCR kit (New England Biolabs E3005E) on a C1000 touch thermal Cycler / CFX384 Real-Time System (Biorad) ...
-
bioRxiv - Biochemistry 2021Quote: ... for 1 hr at 37 °C and Proteinase K (4 U; P8107S, NEB, Ipswich, MA) for another 2 hr at 55 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... each with 1 μg of gDNA first being digested with 4 U of MmeI (NEB) for 2 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL 10× Poly(A) Polymerase Reaction Buffer and 1 μL Poly(A) Polymerase (NEB) for poly(A ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Plugs were rinsed with TE and then washed with 1 ml NEB buffer 4 (NEB) 3 × 15min ...
-
bioRxiv - Genomics 2019Quote: ... expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1) expressing ATG7 isoform 1 was derived from pCMV-myc-Atg7(2) using the Q5 site-directed mutagenesis kit (NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Biophysics 2020Quote: ... By replacing dCTP with 5-methyl-dCTP (New England BioLabs, Ipswich, MA) in the nucleotide mix ...
-
bioRxiv - Cancer Biology 2021Quote: ... or enzymatic methylation conversion (Enzymatic Methyl-seq Conversion Module, NEB Product #E7125L) to convert unmethylated cytosine to uracil ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed by using the NEBNext Enzymatic Methyl-seq Kit (NEB), following manufacturer’s guidance ...
-
bioRxiv - Genetics 2021Quote: ... EagI/KpnI-digested ORFs were ligated into the EagI/KpnI-digested pUASTattB vector backbone using a 6:1 insert:vector molar ratio and T4 DNA ligase (M0202S, NEB) in a thermocycler overnight (∼16 hr) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and subsequently mixed at a 6:1 ratio with the digested backbone in reactions containing T4 DNA ligase (NEB).
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Microbiology 2022Quote: ... and exon 7 (BSErI, NEB). PCR amplicons were also purified with MinElute PCR Purification Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... 2 µg of DNA were digested for 4 hours with MmeI (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NEBNext Multiplex Oligos for Illumina Primer sets 1 and 2 (New England Biolabs). The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μL RT Adapter (RTA)(SQK-RNA002) and 2 μL T4 DNA Ligase (NEB) were mixed together and incubated under 25 °C for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... and NEBNext Multiplex Oligos for Illumina (NEB Set 1 E7335 and Set 2 E7500S). Additional AMPure clean-ups at the start and the end of library preparation were included ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 μl T4 RNA ligase 2 (truncated K227Q, NEB, M0242, 200,000 units/ml) and incubated at 16°C for 14 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Resulting PCR amplicons were denatured and re-annealed in 1 × NEB buffer 2 (NEB) in a total volume of 9 μl using a following conditions ...
-
bioRxiv - Genomics 2023Quote: ... 20 of 2 U µL-1 Phusion High-Fidelity DNA Polymerase (New England Biolabs), 160 µL of 40 U µL-1 Taq DNA ligase (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). The Hifi assembly products were Ampure bead purified and eluted into 20 µL of H2O ...
-
bioRxiv - Microbiology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour HiFi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). HiFi assembly products were Ampure bead purified and eluted into 20uL of H2O for higher electroporation efficiency.
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... Custom oligos flanking the targeted sites were used to amplify genomic DNA from pooled edited cells (Supplementary Table 7) using High-Fidelity 2× Master Mix (New England Biolabs). Indel frequencies were quantified by comparing unedited control and knockout cell lines using Inference of CRISPR Edits (ICE)73.
-
bioRxiv - Cancer Biology 2021Quote: ... samples were mixed with 7 μl 5x Ultra II FS buffer and 2 μl Ultra II FS enzyme (New England BioLabs), and incubated 12 minutes at 37 °C followed by 30 minutes at 65 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... Gel-purified cDNA products were ligated to the adapter oWG920 (Supplementary Table 6) using T4 RNA ligase 1 (NEB M0437M). cDNA cleanup was performed using 10 µl MyOne Silane beads (Thermo Scientific 37002D ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All digested products were column purified and mixed at a 6:1 molar ratio in the presence of T4 DNA ligase (NEB).
-
bioRxiv - Biochemistry 2021Quote: ... 150 μl of the remaining sample was mixed with 6 μl (1 μl per 25 μl sample volume) of Thermolabile Proteinase K (NEB), incubated at 37 °C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... were PCR-amplified using primers that contained restriction sites for EcoRI and SacI (Table S5, primers No. 1-6) and the high-fidelity polymerase Q5 (New England Biolabs) according to vendor’s manual ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from 1 μg of total RNA using M-MuLV Reverse Transcriptase and Random Primers 6 (both New England Biolabs) at 42 °C for 60 min and diluted in 1:4 ratio by PCR grade water ...
-
bioRxiv - Plant Biology 2020Quote: ... for sgRNA-LecRK-I.1 and pMR218 (L5-L2) for sgRNA-LecRK-I.6 via a cut-ligation reaction with BbsI (New England Biolabs) and T4 DNA ligase (New England Biolabs) ...